left mid and right copying portions of a text string
báo cáo hóa học:" Mid-term results and factors affecting outcome of a metal-backed unicompartmental knee design: a case series" pptx
... femoral and tibial angles, alpha and beta angles, and medial and lateral joint spaces as described by Villers and Cartier [7] Patients were additionally evaluated for the presence of patellar osteophytes ... standard deviation ap values were calculated based on Wilcoxon matched-pairs signed-ranks tests for continuous variables and chi-squared tests for categorical variables a mean of 95 (SD = 4) and ... the same patient (A) and Merchant view at radiographs of Antero-posterioras Figures and 2, taken(B) 41 month folAntero-posterior (A) and Merchant view (B) radiographs of the same patient as Figures...
- 7
- 272
- 0
Báo cáo y học: "Acute pressure overload of the right ventricle. Comparison of two models of right-left shunt. Pulmonary artery to left atrium and right atrium to left atrium: experimental study" doc
... baseline Statistical Analysis Data is expressed as mean ± standard deviation (S.D.) or median (in case of violation of normality) for continuous variables and as percentages for categorical data ... pulmonary artery pressure proximal of the banding was double than pressure distally of the banding RVF following pulmonary artery banding was defined as a Materials and methods Surgical Preparation ... radius Because of the anatomical contiguity between pulmonary artery and left atrium, the length of the PA-LA graft is always shorter than the RA-LA graft The pressure gradient PA-LA is always higher...
- 10
- 337
- 0
Tài liệu FRONTIERS IN UNDERSTANDING CLIMATE CHANGE AND POLAR ECOSYSTEMS REPORT OF A WORKSHOP docx
... observations, data synthesis and management, and data dissemination and outreach Copyright © National Academy of Sciences All rights reserved Frontiers in Understanding Climate Change and Polar ... University of Victoria, Canada SVEN D HAAKANSON, Alutiiq Museum, Kodiak, Alaska AMY LAUREN LOVECRAFT, University of Alaska, Fairbanks MOLLY MCCAMMON, Alaska Ocean Observing System, Anchorage ELLEN MOSLEY-THOMPSON, ... Sea ice also provides an important habitat for birds and mammals (e.g., penguins, polar bears, walrus, and seals) that use the ice as a foraging platform or breeding habitat Arctic and Antarctic...
- 87
- 467
- 0
Gold, Peace, and Prosperity..Gold, Peace, and Prosperity:The Birth of a New Currency Second pptx
... delight of the bureaucrats, politicians, international bankers, multinational corporations, and some labor leaders The age of the managed fiat currency was born The M anaged Fiat Currency Standard As ... a seamless web They cannot be separated, and they stand or fall together Ron Paul understands that all three parts of this system of liberty have been under grave attack for decades, and that ... standard, the CPI increased 10 percent In his 1848 Communist Manifesto, Karl Marx urged: “Centralization of credit in the hands of the state, by means of a national bank with state capital and...
- 111
- 1,231
- 0
Báo cáo khoa học: Phosphorylation modulates the local conformation and self-aggregation ability of a peptide from the fourth tau microtubule-binding repeat pdf
... Correas I, Nieto A & Avila J (1988) Tau factor polymers are similar to paired helical filaments of Alzheimer’s disease FEBS Lett 236, 150–154 42 Mendieta J, Fuertes MA, Kunjishapatham R, SantaMaria ... shifts and negative values are upfield shifts NH and 0.10 p.p.m for aH) In general, the chemical shift of NH deviates was more than that of aH upon phosphorylation Notable chemical shift deviation of ... CD spectra for R4 and pR4 are characterized by a strong negative apex at 198 nm (Fig 3), which indicates a large amount of random coil structure [36] No remarkable structural perturbation is...
- 9
- 428
- 0
Báo cáo khoa học: Critical roles of Leu99 and Leu115 at the heme distal side in auto-oxidation and the redox potential of a hemeregulated phosphodiesterase from Escherichia coli pptx
... La Jolla, CA, USA) with pET2 8a( +)-wild-type Ec DosH as a template and using the following respective 5¢-sense primers: 5¢-gatga gtcgggagACCcagctggagaaaaaag-3¢, 5¢-gatgagtcgggagTTTcag ctggagaaaaaag-3¢, ... Yokota et al Sato A, Sasakura Y, Sugiyama S, Sagami I, Shimizu T, Mizutani Y & Kitagawa T (2002) Stationary and timeresolved resonance Raman spectra of His77 and Met95 mutants of the isolated ... whereas Ala and Asn substitutions at Asp40, an amino-acid residue that interacts via two water molecules with the proximal ligand His77, markedly increased the rate of auto-oxidation [13] (Table...
- 14
- 390
- 0
Measuring and modelling the performance of a parallel ODMG compliant object database server potx
... development of a parallel object database server is given in [14] An early parallel object database project was Bubba [15], which had a functional query language FAD Although the Bubba model and languages ... optimization and parallelization are automatic, having as a result an operator tree that represents a query’s evaluation plan Although all of them implement some form of intra-transaction parallelism, ... Muralikrishna M Gamma a high performance dataflow database machine Proceedings of the International Conference on Very Large Data Bases, Kyoto, Japan, August 1986 Morgan Kaufmann: San Mateo, CA,...
- 47
- 1,604
- 0
synthesis, electrical measurement, and field emission properties of a-fe2o3 nanowires
... is a constant for all of the as-produced a- Fe2O3 NWs Using the mean length and radius of the NWs, RNW (or Roverall) of samples A, B, C, and D was calculated as 1.25 1011, 1.4 1011, 1.4 1011, and ... Nanoscale Res Lett (2008) 3:330–337 331 thermally stable, resistant to oxidation, and have a high aspect ratio, a- Fe2O3 NWs are a candidate emitters for FE applications It has been reported ... process of the PR Figure 6a and b shows the morphology image and current image, respectively, taken at a ?10 V bias on a single NW The tip used for CAFM was an Au-coated silicon tip, with a diameter...
- 8
- 403
- 0
Internal Audit 2012*: A study examining the future of internal auditing and the potential decline of a controls-centric approach docx
... key trading-partner areas Internal Audit 2012 14 • The CAE of a global defense and aerospace company that buys parts from around the world said that vendor quality and standards are of primary ... internationalization of accounting standards may lead to a change in the language of accounting • The growth of outsourcing and an upsurge in the offshoring of services and manufacturing have made ... internal audit today and in the future As organizations expand to take advantage of global markets and supply chains, internal audit faces a burgeoning need for its services A majority of survey...
- 68
- 456
- 0
Báo cáo khoa học: Substrate specificity of the human UDP-glucuronosyltransferase UGT2B4 and UGT2B7 Identification of a critical aromatic amino acid residue at position 33 doc
... CTTTATATTCATCCAGTGGCTGTATTCTGTGGGCCACACCAG CTGGTGTGGGCAGCAGAACTCAGCCATTGGATGAATATAAAG CTTTATATTCATCCAATGGCTGAGTTCTGCTGCCCACACCAG CTGGTGTGGGCAGCAGAATACAGCCATTGGATGAATATAAAG CTTTATATTCATCCAATGGCTGTATTCTGCTGCCCACACCAG ... Sense Antisense Sense Antisense Sense Antisense Sense Antisense CTGGTGTGGCCCACAGAACTCAGCCACTGGATGAATATAAAG CTTTATATTCATCCAGTGGCTGAGTTCTGTGGGCCACACCAG CTGGTGTGGCCCACAGAATACAGCCACTGGATGAATATAAAG CTTTATATTCATCCAGTGGCTGTATTCTGTGGGCCACACCAG ... LumiGLOTM was from Cell Signaling (Beverly, MA, USA), and AdvantageÒ polymerase mix was from Clontech (Palo Alto, CA, USA) All other reagents were of the best quality and commercially available Expression...
- 9
- 343
- 0
ELECTRONIC SCIENTIFIC, TECHNICAL, AND MEDICAL JOURNAL PUBLISHING AND ITS IMPLICATIONS REPORT OF A SYMPOSIUM docx
... early adopters reap the benefits of innovation in attracting authors and readers Eventually, many of the innovative features become generally adopted, and usually at a lower cost of adoption than ... well-known example of such an open access archive is PubMed Central, maintained by the National Library of Medicine Advantages of the Open-Access Approach for Science The practical advantages of true ... scientific and technical matters Dr Bruce M Alberts is president of the National Academy of Sciences The National Academy of Engineering was established in 1964, under the charter of the National Academy...
- 122
- 405
- 0
Báo cáo khoa học: Determination of the metal ion dependence and substrate specificity of a hydratase involved in the degradation pathway of biphenyl/chlorobiphenyl pot
... Ontario, Canada) or New England Biolabs (Pickering, Ontario, Canada) All other chemicals were of analytical grade and were obtained from Sigma-Aldrich and Fisher Scientific (Nepean, Ontario, Canada) ... kcat value compared with the methyl substituted substrate Discussion HPDA hydratase, an enzyme in the meta-cleavage pathway of aromatic compounds, catalyzes a hydration reaction via a proposed anion ... preparation after anion exchange (lane 2); preparation after hydrophobic column chromatography (lane 3), preparation after gel filtration (lane 4) The molecular mass of the proteins in the standard...
- 9
- 461
- 0
Báo cáo khoa học: A possible physiological function and the tertiary structure of a 4-kDa peptide in legumes potx
... the 4-kDa peptide N-terminal primer: 5¢-AACCATGGCTAAAGCAGATTGTAATGG TGCATGT-3¢; the 4-kDa peptide C-terminal primer: 5¢-AAGAATTCTTATTATCCAGTTGGATGTATGCA GAA-3¢ The amplified sequence was cloned ... were amplified by PCR strategy using the azuki bean and mung bean genomic DNAs as templates and the synthetic primers legF1 (5¢-AGC AGCAGATTGTAATGGTG-3¢) and legR1 (5¢-CAGC ACTTCAGAATCAGAGTC-3¢) ... studies revealed that a small amount of 4-kDa peptide is localized around the plasma membranes and cell walls [9] The subcellular localization of 4-kDa peptide is similar to that of the 43-kDa protein,...
- 8
- 386
- 0
the impact of internet banking on banks a descriptive and evaluative case study of a large united states bank (lusb)
... initiating transactions such as deposits and loans (Siebel, 2005) Some banks also shifted some activities traditionally offered by bank branches such as small-business loan approval and management ... the participating banks’ websites, press releases, annual reports, third-party databases, and online survey of Internet banking management The study described and evaluated six large banks and ... impersonal and emotionless The use of automated answering machines and computer robots that handled customer calls after working hours were impersonal, and a live person was not easily available...
- 269
- 712
- 0
Báo cáo hóa học: " Research Article Stability Analysis and Intermittent Control Synthesis of a Class of Uncertain Nonlinear Systems" doc
... control, and some exponential stability criteria are established Finally, some conclusions and remarks are drawn in Section Problem Formulation and Preliminaries Consider a class of nonlinear uncertain ... ≥ to denote a positive negative, seminegative, and semipositive definite matrix P Journal of Inequalities and Applications Exponential Stabilization of a Class of Uncertain Nonlinear System This ... stability criteria have been given in terms of a set of linear matrix inequalities, and stabilization periodically intermittent state feedback controllers are proposed Finally, a numerical example...
- 13
- 444
- 0
báo cáo hóa học:" Research Article Iterative Methods for Finding Common Solution of Generalized Equilibrium Problems and Variational Inequality Problems and Fixed Point Problems of a Finite Family of Nonexpansive Mappings" pdf
... Combettes and S A Hirstoaga, “Equilibrium programming in Hilbert spaces,” Journal of Nonlinear and Convex Analysis, vol 6, no 1, pp 117–136, 2005 A Moudafi and M Th´ ra, “Proximal and dynamical approaches ... spaces,” Journal of Mathematical Analysis and Applications, vol 331, no 1, pp 506–515, 2007 11 S Takahashi and W Takahashi, “Strong convergence theorem for a generalized equilibrium problem and ... problems,” Journal of Mathematical Analysis and Applications, vol 344, no 1, pp 340– 352, 2008 10 S Takahashi and W Takahashi, “Viscosity approximation methods for equilibrium problems and fixed point...
- 29
- 316
- 0
báo cáo hóa học:" Research Article Evaluation and Design Space Exploration of a Time-Division Multiplexed NoC on FPGA for Image Analysis Applications" docx
... parameterized architecture dedicated to image analysis applications on FPGA All flows and data are analyzed to propose two generic NoC architectures, a ring for results and command and a dedicated ... packet and associated state information Several virtual channels may share the bandwidth of a single physical channel [17] It allows minimization of the size of the router’s buffers a significant ... structure is dynamic in order to adapt to different types of data The length of packet and data, number and size of flits, and the depth of VC are all parameterized The size of flits can be 8, 16,...
- 15
- 389
- 0
Báo cáo hóa học: " Research Article An Extragradient Approximation Method for Equilibrium Problems and Fixed Point Problems of a Countable Family of Nonexpansive Mappings" docx
... problems and fixed point problems in Hilbert spaces,” Journal of Mathematical Analysis and Applications, vol 331, no 1, pp 506–515, 2007 Rabian Wangkeeree 17 12 K Aoyama, Y Kimura, W Takahashi, and ... W Takahashi, Nonlinear Functional Analysis, Yokohama Publishers, Yokohama, Japan, 2000 14 R T Rockafellar, “On the maximality of sums of nonlinear monotone operators,” Transactions of the American ... such scheme In this paper, motivated by Yao et al 10 , S Takahashi and W Takahashi 11 and Aoyama et al 12 , we introduce a new extragradient method 4.2 which is mixed the iterative schemes considered...
- 17
- 324
- 0
Báo cáo hóa học: " Synthesis, Electrical Measurement, and Field Emission Properties of a-Fe2O3 Nanowires" potx
... is a constant for all of the as-produced a- Fe2O3 NWs Using the mean length and radius of the NWs, RNW (or Roverall) of samples A, B, C, and D was calculated as 1.25 1011, 1.4 1011, 1.4 1011, and ... Nanoscale Res Lett (2008) 3:330–337 331 thermally stable, resistant to oxidation, and have a high aspect ratio, a- Fe2O3 NWs are a candidate emitters for FE applications It has been reported ... process of the PR Figure 6a and b shows the morphology image and current image, respectively, taken at a ?10 V bias on a single NW The tip used for CAFM was an Au-coated silicon tip, with a diameter...
- 8
- 270
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu