learning from deficiency gene targeting of caspases

Báo cáo sinh học: "In vivo gene targeting of IL-3 into immature hematopoietic cells through CD117 receptor mediated antibody gene delivery" pot

Báo cáo sinh học: "In vivo gene targeting of IL-3 into immature hematopoietic cells through CD117 receptor mediated antibody gene delivery" pot

... Genetic Vaccines and Therapy 2004, 2:16 Introduction In vivo gene targeting of highly specific cell subsets remains the main challenge for gene therapy of a broad range of conditions ... (AGAGCTCGTTTAGTGAACCG) located on both sides of the IL-3 gene (into the multiple cloning site of pCEP4), which resulted in a PCR product specific of the gene inserted in the pCEP4 Nested PCR was ... site of clonage of pCEP4 plasmid These pairs of primers allow for detection of a 542 bp fragment when electrophoresed on a 2% agarose gel and visualization with ethidium bromide Specificity of...

Ngày tải lên: 14/08/2014, 19:22

8 246 0
Báo cáo Y học: ORF6 from the clavulanic acid gene cluster of Streptomyces clavuligerus has ornithine acetyltransferase activity potx

Báo cáo Y học: ORF6 from the clavulanic acid gene cluster of Streptomyces clavuligerus has ornithine acetyltransferase activity potx

... acetylation of the b subunit The Orf6 gene was amplified by PCR from wild-type S clavuligerus genomic DNA (from GlaxoSmithKline) and directly cloned into the PCR-ScriptTM vector (Stratagene) The ... Autoproteolytic processing of ORF6 SDS/PAGE analysis of the purified ORF6 showed the protein as two distinct bands, with approximate masses of 19 and 25 kDa (Fig 1) From its gene sequence, ORF6 is ... amino-acid sequence of the 19-kDa band (from pTYB11) was shown to be MSDSTPKTPR, identical to that expected for the N-terminus of ORF6 This was Ó FEBS 2002 ORF6 from the clavulanic acid gene cluster...

Ngày tải lên: 08/03/2014, 22:20

8 509 0
Báo cáo Y học: Propionate CoA-transferase from Clostridium propionicum Cloning of the gene and identi®cation of glutamate 324 at the active site pdf

Báo cáo Y học: Propionate CoA-transferase from Clostridium propionicum Cloning of the gene and identi®cation of glutamate 324 at the active site pdf

... DNA-sequencing A degenerated primer pair was deduced from the N-terminus of the enzyme and from an internal peptide (Table 2) and used to amplify a % 300-bp PCR product from genomic DNA of C propionicum ... peptides were generated by cleavage with trypsin and puri®ed to homogeneity by RP-HPLC Two of these peptides were sequenced by Edman degradation A degenerated primer pair was deduced from the N-terminus ... the transferase gene This gene probably encodes one subunit of the (R)lactoyl-CoA dehydratase required in the reductive pathway from alanine to propionate Directly downstream of the propionate...

Ngày tải lên: 17/03/2014, 17:20

9 499 0
Báo cáo khoa học: "Learning from evolving data streams: online triage of bug reports" potx

Báo cáo khoa học: "Learning from evolving data streams: online triage of bug reports" potx

... description of issue Content of issue report, which may include steps to reproduce, error messages, stack traces etc ID of report submitter List of IDs of people CC’d on the issue report List of tags ... Online learning This paucity of research on online learning from issue tracker streams is rather surprising, given that truly incremental learners have been wellknown for many years In fact one of ... scores for the whole stream The curves show a moving average of MRR in a window comprised of 7% of the total number of items In most of the plots it is evident how the prediction performance depends...

Ngày tải lên: 24/03/2014, 03:20

10 432 0
Báo cáo sinh học: " Phenotype and envelope gene diversity of nef-deleted HIV-1 isolated from long-term survivors infected from a single source" pptx

Báo cáo sinh học: " Phenotype and envelope gene diversity of nef-deleted HIV-1 isolated from long-term survivors infected from a single source" pptx

... Wolinsky SM, Gabuzda D: Genetic and functional analysis of full-length human immunodeficiency virus type env genes derived from brain and blood of patients with AIDS Journal of Virology 2003, 77(22):12336-12345 ... alignments of the V1V2 and V3 regions of Envs cloned from each virus are shown in Fig 7A and 7B, respectively The net charge of the V3 regions of D36E and D36L clones was +6, and the net charge of the ... coreceptor usage of human immunodeficiency virus type (HIV1) from macrophage tropism reveals biological properties of CCR5-restricted HIV-1 isolates from patients with acquired immunodeficiency syndrome...

Ngày tải lên: 18/06/2014, 18:20

12 401 0
Báo cáo hóa học: " Characterization of an Egyptian Spodoptera littoralis nucleopolyhedrovirus and a possible use of a highly conserved region from polyhedrin gene for nucleopolyhedrovirus detection" potx

Báo cáo hóa học: " Characterization of an Egyptian Spodoptera littoralis nucleopolyhedrovirus and a possible use of a highly conserved region from polyhedrin gene for nucleopolyhedrovirus detection" potx

... companies The full length of polyhedrin gene from lepidopteran NPVs ranged from 483 bp to 747 bp [39] In case of polyhedrin gene from Spodoptera sp NPVs, its full length ranges from 510 bp to 747 bp ... virus stock of NPV from Autographa californica nuclear polyhedrosis virus (AcMNPV; E2 strain) was originally obtained from Prof Dr Suzanne Thiem, Department of Entomology, University of Michigan, ... highly conserved region of polyhedrin gene (polh-cr) On comparing amino acid sequence of the putative polypeptide of Polh-cr (Acc# AAR04375) to its corresponding sequences of AcMNPV (Acc# AAA46736)...

Ngày tải lên: 20/06/2014, 01:20

11 854 0
Statistics The Art and Science of Learning from Data pot

Statistics The Art and Science of Learning from Data pot

... Science of Learning from Data This page intentionally left blank Statistics The Art and Science of Learning from Data Third Edition Alan Agresti University of Florida Christine Franklin University of ... Student Edition of MINITAB® (CD Only) The Student Edition of MINITAB is a condensed version of the Professional Release of MINITAB statistical software It offers the full range of statistical ... statistical software, and generate compelling reports • Integration of Statistical Software: Knowing that students often use external statistical software, we make it easy to copy our data sets, both from...

Ngày tải lên: 28/06/2014, 20:20

834 2,5K 0
Báo cáo y học: "Lack of association between mannose-binding lectin gene polymorphisms and juvenile idiopathic arthritis in a Han population from the Hubei province of China" docx

Báo cáo y học: "Lack of association between mannose-binding lectin gene polymorphisms and juvenile idiopathic arthritis in a Han population from the Hubei province of China" docx

... polymorphism in codon 57 of the MBL gene Discussion MBL is one of the most important constituents of the innate immune system [10,11] Many studies have reported a deficiency of MBL in different populations ... frequencies of codon 54 did not show significant differences compared with those of healthy controls from Hong Kong and Europe [6,7] The mutation type of codon 54 was seen in 25.0% of Chinese ... independent pathway of complement activation [2] Mutation and deficiency of the MBL codon could impair the ability of pathogen or immunecomplex clearance, facilitating the development of autoimmunity...

Ngày tải lên: 09/08/2014, 08:22

4 318 0
Báo cáo y học: " Learning from the U.S. Department of Veterans Affairs Quality Enhancement Research Initiative: QUERI Series Ian D Graham* and Jacqueline Tetroe" potx

Báo cáo y học: " Learning from the U.S. Department of Veterans Affairs Quality Enhancement Research Initiative: QUERI Series Ian D Graham* and Jacqueline Tetroe" potx

... science of implementation, such as research on the determinants of knowledge use, the effectiveness of interventions to increase the application of knowledge in real-world settings, and studies of ... data from this step/phase referred to in a thematic paper (step 6) This will provide the ultimate validation of QUERI's effectiveness While some studies of multi-region and national roll-out of ... contexts The only potential deficit of the current version of the framework is that it lacks explicit reference to a step about maintenance or sustainability of quality improvement programs No...

Ngày tải lên: 11/08/2014, 05:21

6 485 0
báo cáo khoa học: " Learning from the U.S. Department of Veterans Affairs Quality Enhancement Research Initiative: QUERI Series" pdf

báo cáo khoa học: " Learning from the U.S. Department of Veterans Affairs Quality Enhancement Research Initiative: QUERI Series" pdf

... science of implementation, such as research on the determinants of knowledge use, the effectiveness of interventions to increase the application of knowledge in real-world settings, and studies of ... data from this step/phase referred to in a thematic paper (step 6) This will provide the ultimate validation of QUERI's effectiveness While some studies of multi-region and national roll-out of ... contexts The only potential deficit of the current version of the framework is that it lacks explicit reference to a step about maintenance or sustainability of quality improvement programs No...

Ngày tải lên: 11/08/2014, 16:20

6 357 0
báo cáo khoa học: " Characterization of microsatellites and gene contents from genome shotgun sequences of mungbean (Vigna radiata (L.) Wilczek)" pptx

báo cáo khoa học: " Characterization of microsatellites and gene contents from genome shotgun sequences of mungbean (Vigna radiata (L.) Wilczek)" pptx

... The distribution of the number of motif repeat ranged from - 30 repeats (Table 1) The most common motif type of DNPs was TA/AT (89.3% of DNPs) followed by TC/AG (7.1% of Page of 12 (page number ... and characterization of putative genes using shotgun genome sequences of Vigna radiata A significance of the results from this study is that highthroughput shotgun sequences of mungbean can be ... construction of linkage map, mungbean genetic improvement, phylogenetic relationship, but also for gene discovery as the paucity of DNA markers in cultivated mungbean has precluded detailed genetic...

Ngày tải lên: 12/08/2014, 03:21

12 306 0
Báo cáo sinh học: "Learning from positive examples when the negative class is undetermined- microRNA gene identification" ppt

Báo cáo sinh học: "Learning from positive examples when the negative class is undetermined- microRNA gene identification" ppt

... an elegant algorithm, positive sample only learning (PSoL), to predict non-coding RNA (ncRNA) genes by generating an optimized negative class of ncRNA from so-called "unlabeled" data using two-class ... recover 97% of the captured true miRNA (0.97*28) while reducing the new miRNA prediction by 42% A threshold of 0.3 recovers 40% of the captured miRNA (0.4*28) and a reduction of about 95% of the new ... of base pairs(bp), (2) the number of bulges, (3) the number of loops, (4) the number of asymmetric loops, (5) eight features representing the number of bulges of lengths 1–7 and greater than 7,...

Ngày tải lên: 12/08/2014, 17:20

9 194 0
Báo cáo y học: " Cell-specific targeting of lentiviral vectors mediated by fusion proteins derived from Sindbis virus, vesicular " doc

Báo cáo y học: " Cell-specific targeting of lentiviral vectors mediated by fusion proteins derived from Sindbis virus, vesicular " doc

... Page of 15 membrane-bound form of SCF in conjunction with an independent fusion domain derived from VSV-G [28,29] or the glycoproteins derived from a non-heparan sulfate-binding strain of Sindbis ... Journal of Gene Medicine 2009, 11:655-663 Morizono K, Pariente N, Xie Y, Chen ISY: Redirecting lentiviral vectors by insertion of integrin-tageting peptides into envelope proteins The Journal of Gene ... retroviral vectors consist of vector particles bearing envelope (Env) glycoproteins derived from other enveloped viruses Such particles possess the tropism of the virus from which the glycoprotein...

Ngày tải lên: 12/08/2014, 23:22

15 176 0
Báo cáo y học: "Insights gained from the reverse engineering of gene networks in keloid fibroblasts" pdf

Báo cáo y học: "Insights gained from the reverse engineering of gene networks in keloid fibroblasts" pdf

... over genes, μeg is the mean value of gene g under our condition of interest, μcg os the mean value of gene g under control conditions, Vareg is the variance of gene g under our condition of interest, ... tumours [4] The goal of reverse engineering methods is to infer gene networks from observational data, thus providing insight into the inner workings of a cell [8,9] There are two general strategies ... the networks However, learning the structure of a gene network using the influence approach is difficult as the number of possibilities scale exponentially with the number of variables Therefore,...

Ngày tải lên: 13/08/2014, 16:20

17 287 0
Báo cáo y học: "Implementation of checklists in health care; learning from high-reliability organisations." pps

Báo cáo y học: "Implementation of checklists in health care; learning from high-reliability organisations." pps

... Drøbak, Norway Department of Surgical Sciences, University of Bergen, Bergen, Norway Department of Medical Sciences, University of Bergen, Bergen, Norway Department of Prehospital Medicine Betanien ... dissemination of the checklist, there are few studies describing the actual process of developing and implementing such tools in health care The aim of this study is to explore the experiences from checklist ... implementation is probably more a matter of will, enthusiasm, and organisational competence than of available time and financial resources [35] Flow of expertise and delegation of authority Health care has...

Ngày tải lên: 13/08/2014, 23:20

26 232 0
Báo cáo sinh học: " A trial of somatic gene targeting in vivo with an adenovirus vector" pdf

Báo cáo sinh học: " A trial of somatic gene targeting in vivo with an adenovirus vector" pdf

... level If the gene targeting of somatic cells is made possible by gene transfer in vivo, it will facilitate the analysis of gene function, and provide a means of gene therapy for genetic and other ... detect gene targeting in vivo Experimental steps to detect gene targeting in vivo Gene targeting in vivo in liver cells was attempted after the delivery of donor DNA with an adenovirus vector The gene ... copies of the target gene, which amount to 0.4% of the genome This should be able to improve the sensitivity of detection of gene targeting, although the sensitivity is limited by spontaneous mutagenesis...

Ngày tải lên: 14/08/2014, 19:22

11 323 0
Elucidating the genetic basis of severe obesity  learning from the experiments of nature

Elucidating the genetic basis of severe obesity learning from the experiments of nature

... recruited to our Obesity Gene Study (OGS) MC3R and MC4R genes of this cohort were screened by direct sequencing The POMC gene of more than 900 DNA samples from the Genetics of Obesity Study (GOOS) ... by many, given the myriad of research in quest of genetic defects downstream to the leptin receptors Leptin deficiency Leptin deficiency from disruption of both leptin genes result in severe obesity ... GENETIC BASIS OF SEVERE OBESITY: LEARNING FROM THE EXPERIMENTS OF NATURE DR LEE YUNG SENG MBBS, MMED (PAED MED), MRCP (UK), MRCPCH, FAMS A THESIS SUBMITTED FOR THE DEGREE OF PH.D DEPARTMENT OF...

Ngày tải lên: 11/09/2015, 09:02

188 266 0
Gene targeting in human pluripotent cell derived neural stem cells for the study and treatment of neurological disorders

Gene targeting in human pluripotent cell derived neural stem cells for the study and treatment of neurological disorders

... 44   3.6   Design of AAV virus for the targeting of ATXN3 gene in human lt-NES cells 45   3.6.1   Generation of homology arms 45   3.6.2   Cloning of targeting vector ... for the generation of modified neuronal cultures 59   4.2   Generation of gene- corrected neural stem cells from MJD patient-derived iPS cells 59   4.2.1   Successful generation of AAV-vectors ... addition of whole genes or the modification of exons or introduction of point mutations Targeting implies its specificity to target uniquely in the genome, in contrast to random integration of genetic...

Ngày tải lên: 26/11/2015, 09:54

135 365 0
Keith potts construction cost management  learning from case studies   spon press (2008)

Keith potts construction cost management learning from case studies spon press (2008)

... the scene Construction overview Influential reports Recommendations from professional bodies Learning from case studies Learning from project failures 10 Relevant observation 11 Conclusion 11 Questions ... Inadequacy of the brief; Failure of client to appreciate disadvantages of the construction management approach – total risk lies with client; Inadequate management of risk; Lack of involvement of key ... approval of revised budget; Lack of audit trail in selection of construction manager (Bovis); Failure of client to take up Bovis’s parent company guarantee; Lack of construction experience of client’s...

Ngày tải lên: 17/08/2013, 10:57

321 618 1
w