lbp or buttock pain as a result of a stress fracture
Báo cáo y học: "Pain as a symptom of peripheral nerve sheath tumors: clinical significance and future therapeutic directions" potx
... factor (NGF) is another algogen that has been commonly implicated as an important cause of both neuropathic and malignant cancer pain For example, Zhu et al found that human pancreatic cancers with ... growth factors [1,16,17] The later two classes of molecules have the particularly appealing characteristic of potentially specific inhibition as a means of alleviating cancer pain In many cancers, ... A, Hotta T, Morita T, Yamamura S, Hosaka N, Kobayashi H, Hirata Y: Tumors of peripheral nerves: correlation of symptoms, clinical signs, imaging features, and histologic diagnosis Skeletal radiology...
- 5
- 377
- 0
Báo cáo y học: "Non union of scaphoid fracture in a cricketer – possibility of a stress fracture: a case report" ppsx
... Scaphoid stress fracture in a 13 year old gymnast: A case report J Hand Surg (Am) 2000, 25(4):710-3 Hanks GA, Kalenak A, Bowman LS, Sebastanelli WJ: Stress fracture of the carpal scaphoid, a ... sports As non union of a scaphoid fracture can cause degenerative arthritis of the radio-carpal articulation any sports person presenting with wrist pain should be investigated for a scaphoid fracture ... manuscript as the main author RSUY was involved in reviewing the literature and proof reading of the manuscript RSUY has approved the final manuscript TMK, the Senior author was responsible for...
- 2
- 222
- 0
Báo cáo Y học: The mitochondrial-lysosomal axis theory of aging Accumulation of damaged mitochondria as a result of imperfect autophagocytosis ppt
... aging A number of early explanations of aging, such as Orgel’s error catastrophe theory and the somatic mutation theory, were based on the idea that aging results from the accumulation of synthetic ... (2000) Autophagy as a regulated pathway of cellular degradation Science 290, 1717–1721 23 Marzella, L., Ahlberg, J & Glaumann, H (1981) Autophagy, heterophagy, microautophagy and crinophagy as the ... life maintenance Mitochondria are the main source of ROS formation, as well as the main target for free radical attack The accumulation of defective mitochondria within aging cells suggests that...
- 7
- 444
- 0
Báo cáo khoa học: Lack of stabilized microtubules as a result of the absence of major maps in CAD cells does not preclude neurite formation pot
... GCTTGAAGGCGCTGGATCTGCGACAATAG GACTGGGCTTTCATCAGCGACAGGTGGC GTGAACCACCAAAATCGGAGAACGAAGC CAGGTTCTCAGTAGAGCCAATCTTCGACCTGAC AGAGTCGGATGCAGTTGCCCGGGCAACA GGCTCCTCCAGCACCCTCCGGGTCCCG CCCCAAACTTGTGACCATCATTC GGAGAAATCATCTTGAGCATAGCG ... GGCTCCTCCAGCACCCTCCGGGTCCCG CCCCAAACTTGTGACCATCATTC GGAGAAATCATCTTGAGCATAGCG CGAACTCTCAAGGGC ATGCATCAGAACCATGCACG AGCCCTACAATTCCATCCTCACC GCTGAAGGAGACGATGAGGGTGA 82898–82923 83581–83552 91489–91517 92431–92404 ... Tau-for Tau-rev STOP-for STOP-rev Doublecortin-for Doublecortin-rev LIS1-for LIS1-rev Tubulin a6 -for Tubulin a6 -rev GAGCTGGAGCCAGTTGAGAAGCAGGG GTTGGTCTCGTCGCTCATCACATCACGAGG GCTTGAAGGCGCTGGATCTGCGACAATAG...
- 14
- 416
- 0
Báo cáo khoa học: Biosynthesis of platelet glycoprotein V expressed as a single subunit or in association with GPIb-IX doc
... Strassel, C., Baas, M.J., Salamero, J., ChasserotGolaz, S., Cazenave, J.P., De La Salle, C & Lanza, F (2001) Biosynthesis and intracellular post-translational processing of normal and mutant platelet ... reported for a calpain-derived fragment of platelet GPV [12] Singly transfected GPV is retained intracellularly as an N-mannose rich 70 kDa form and is released into the cell supernatant as a ... Immunoprecipitation and SDS/PAGE Materials and cell lines The mAbs V.1 and V.5 against GPV, ALMA.12 against GPIba, ALMA.16 against GPIX and RAM.1 against GPIbb, were developed in our laboratory [19]...
- 7
- 363
- 0
Appendix I Reports Issued as a Result of GAO''''s Audit of IRS'''' Fiscal Years 1992 and 1993 Financial Statements and Status of Recommendations_part1 ppt
... This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com ... This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com...
- 11
- 306
- 0
Appendix I Reports Issued as a Result of GAO''''s Audit of IRS'''' Fiscal Years 1992 and 1993 Financial Statements and Status of Recommendations_part2 pdf
... This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com ... This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com...
- 11
- 282
- 0
Báo cáo hóa học: " Bilateral hemotympanum as a result of spontaneous epistaxis" doc
... often associated with temporal traumas rather than nasal packing [1], but occasionally nasal packing, which can lead to peritubal lymphatic stasis, is a cause of hemotympanum [11] Dysfunction of ... arteriosclerotic vascular diseases are possible systemic factors [5,6] Also regular uptake of anticoagulants can cause spontaneous bilateral hemotympanum [7] The vascular supply of nasal mucosa originates ... topical sprays or dust, inflammatory nasal diseases, septal deformities, tumors and vascular aneurysms can be the local factors [5,6] Coagulation deficits, Osler-Weber-Rendu disease and arteriosclerotic...
- 3
- 334
- 0
Báo cáo sinh học: "Generalized immune activation as a direct result of activated CD4+ T cell killing" doc
... activation and an attenuated innate response has been correlated with the non-pathogenic nature of SIV infection in sooty mangabeys [39] Incomplete removal of apoptotic material as a result of accelerated ... Hamilton, USA) was free of lactate dehydrogenase-elevating virus and was obtained as previously described [57] FV was propagated in vivo and prepared as 10% w/v homogenate from the spleen of 12-day infected ... USA) Fisher’s exact test was used specifically for the non-parametric comparison of P murina-infected and non-infected mice Additional data files The following additional data files are available...
- 18
- 244
- 0
Báo cáo khoa học: "Alteration of nitrergic neuromuscular transmission as a result of acute experimental colitis in rat" pot
... :2 esahP gnilpmas fo yad emas eht no deyassa dna ,C°02− ni derots erew selpmas amsalp ehT amsalp eht etarapes ot g × 005,1 yletamixorppa ta nim 51 rof degufirtnec saw elpmas hcae ,noitcelloc ... dohtem yassa lacigoloiborcim a gnisu denimreted erew snoitartnecnoc emipefec amsalp ehT o dohtem lacitylanA esahp ni sa demrofrep erew serudecorp gnilpmas eht dna esod emas eht ta ylralucsumartni ... stnegA borcimitnA sesamatcal-ateb murtceps-dednetxe gnicudorp sniarts tsniaga scitoibitna matcal-ateb fo seitivitcA I sarerraC ,AG ybocaJ 31 305 -994 ,82 ,5002 rehT locamrahP teV J sewe ot setuor...
- 5
- 205
- 0
Báo cáo y học: "A comparative study of the inhibitory effects of interleukin-1 receptor antagonist following administration as a recombinant protein or by gene transfer." pps
... situations, such as that reported in Figs and 5, the importance of maintaining the local level of IL-1Ra became dramatically apparent, as were the advantages of gene transfer as a means of protein ... IL-1Ra gene therapy has demonstrated impressive efficacy in animal models of RA and OA, and a phase I human trial has recently confirmed that the human IL-1Ra cDNA can be safely transferred to and ... cellular level, the advantage of gene transfer as a means of drug delivery arises from the sustained availability of IL-1Ra that this method permits Materials and method Materials Ham’s F12 medium,...
- 9
- 421
- 0
Báo cáo y học: "Off-pump or Minimized On-pump Coronary Surgery - Initial experience with Circulating Endothelial Cells (CEC) as a supersensitive marker of tissue damage" pptx
... peripheral blood, detached from vessel walls as a result of injury via mechanical strain or disease or inflammation via paracrine or endocrine factors The correlation of CEC and cardiovascular disease ... surgery Ann Thorac Surg 2010; 90: 1134-41 26 Takagi H, Tanabashi T, Kawai N, Umemoto T Off-pump coronary artery bypass sacrifices graft patency: meta analysis of randomized trials J Thorac Cardiovasc ... Descriptive statistics were computed for variables of interest and analyzed using univariate ANOVA Continuous data were analyzed using ANOVA with repeated measures Significance was assumed with a p-value...
- 29
- 344
- 0
báo cáo khoa học: "Epidural varicosis as a possible cause of radicular pain: a case report" docx
... embolism was found to be caused by hypoplasia of her inferior vena cava, with a bilateral occlusion of her vena iliaca communis A diagnostic evaluation showed that a collateral pathway with ectatic ... diagnosis of radicular complaints A review of the recent literature and the case of our patient shows that the presence of epidural varicosis, without also being aware of a vascular abnormality, ... cause of the pathology in the inferior vena cava lead to significantly better results [11] This is not always possible where there is hypoplasia and /or aplasia of the inferior vena cava, so, as...
- 3
- 279
- 0
báo cáo khoa học: "Vulval elephantiasis as a result of tubercular lymphadenitis: two case reports and a review of the literature" pptx
... past tuberculosis, leading to a blockage of lymphatic drainage and resulting in vulval elephantiasis Conclusions Vulval elephantiasis is very rare, and vulval elephantiasis as a consequence of ... skin flaps that was managed by aspiration and pressure bandaging She also experienced episodes of serous discharge from the site that was self limiting and was managed by pressure bandaging Case ... normal She was taken up for surgery after the correction of her anemia A wide local excision with a primary closure was performed Part of the fibro-fatty tissue of her labia majora was preserved...
- 5
- 457
- 0
Báo cáo y học: "Acute small bowel obstruction as a result of a Meckel''''s diverticulum encircling the terminal ileum: A case report" pdf
... Hospital with a 3-day history of abdominal pain, vomiting, absolute constipation and abdominal distension The abdominal pain initially started as a dull generalised discomfort, but later became ... past medical history of only hypercholesterolaemia http://www.jmedicalcasereports.com/content/1/1/8 tified, the decision was made to perform a diagnostic laparotomy and manage the patient accordingly ... on clinical judgement based on the history and physical examination of the patient The cardinal symptoms and signs are colicky abdominal pain, vomiting, absolute constipation and abdominal distension,...
- 5
- 311
- 0
Báo cáo y học: " Oedema of the metatarsal heads II-IV and forefoot pain as an unusual manifestation of Lyme disease: a case report" ppsx
... to have foot pain He was not taking any medication except for the NSAIDs, and had no known allergies Likewise, his family history was unremarkable, and he had a normal social history Gait analysis ... Diagnosis, treatment, and prevention of Lyme disease in children Paediatr Drugs 2003, 5:363-72 In cases of patients with unusual pain such as a metatarsalgia of the fore foot, an algorithm for ... Köhler, Morton neurinoma, instability of the metatarsophalangeal joint, claw toes, fractures of the fore foot, tumors, verrucae plantares and arthritis of the metatarsophylangeales (articular gout,...
- 3
- 311
- 0
Báo cáo y học: " Unique challenges for appropriate management of a 16-year-old girl with superior mesenteric artery syndrome as a result of anorexia nervosa: a case report" pptx
... Surgical therapy may involve duodenojejunoanastomosis or gastrojejunoanastomosis aimed at bypassing the area of obstruction Alternative surgical management may be removal of the ligament of Treitz ... reviewed, and given that the standardized mortality ratio of patients with anorexia nervosa compared with the general population is 11.6 for all causes of death and 56.9 for suicide, anorexia nervosa ... superior mesenteric artery and the aorta (Figure 2) The patient underwent immediate nasogastric tube decompression, resulting in relief of her epigastric pain and drainage of approximately 100 ml of...
- 5
- 312
- 0
Báo cáo y học: " Pelvic digit as a rare cause of chronic hip pain and functional impairment: a case report and review of the literature" pps
... (onychoosteodysplasia) is a hereditary condition with dysplastic or absent nails and absent or hypoplastic kneecaps (nailpatella syndrome) Other characteristic features include iliac horns and abnormality of ... literature For example, Lame [5] and Granieri and Bacarini [7] described a total of six cases, all consisting of a bony structure of at least two bony elements and at least one (pseudo-) articulation ... Journal of Medical Case Reports 2009, 3:139 http://www.jmedicalcasereports.com/content/3/1/139 removal was consistent with a rib, as in our patient The authors postulated that the abnormal bone originated...
- 3
- 289
- 0
Báo cáo y học: "Pancreas divisum and duodenal diverticula as two causes of acute or chronic pancreatitis that should not be overlooked: a case report" doc
... physiological state and, at rest, has a maximum measurement of mm It drains the secretions from the head, body and tail of the exocrine pancreas, and ends at the major duodenal papilla (hepatopancreatic ... 55:543-547 Kamisawa T, Tu Y, Egawa N, Tsuruta K, Okamoto A, Kamata N: MRCP of congenital pancreaticobiliary malformation Abdom Imaging 2007, 32:129-133 Lehman GA: Acute recurrent pancreatitis Can J Gastroenterol ... emergency ultrasound showed lithiasis of the gallbladder, dilation of the main bile duct (9 mm), and a 12 mm hypoechogenic area adjacent to the head of the pancreas It was initially diagnosed as a cystic...
- 4
- 267
- 0
Báo cáo y học: "HIV transmission as a result of drug market violence: a case report" pdf
... the analyses of the interview data and prepared the first draft of the article All authors contributed to the design of the study as well to the drafting and revision of the manuscript All authors ... infection Additionally, comparison of data from study records and the qualitative interview revealed a high level of consistency in reported behavior and agreement between data sources Authors' contributions ... contact resulting from violence has previously been documented as a route of HIV transmission, the details of this case support the conclusion that an assault was very likely the source of infection...
- 3
- 244
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008