lb bbl of kcl the potassium ion concentration in mg l c
Báo cáo khoa học: Limited mutagenesis increases the stability of human carboxypeptidase U (TAFIa) and demonstrates the importance of CPU stability over proCPU concentration in down-regulating fibrinolysis doc
Ngày tải lên :
07/03/2014, 12:20
... CPU-for1 (tgctctagagcg gccgcgggatgaagctttgcagccttgcagtccttgtacc); reverse: C- HIS1rev (atgatgatgcttatcgtcatcgtccccgggctcgagaacattcctaatga cat gccaagc) and C- HIS2rev (cggggtaccttattaagatccactatgatga ... mm KCl, 10 mm Tris ⁄ HCl, pH 8.3, mm MgCl2, 0.01% (w ⁄ v) gelatine, 0.3 lm of each primer CPU_fwd_XhoI (atactcgagccaccatgaagctttgcagccttgc) and CPU_rev_NotI (atcatgcggccgcttaaacattcctaatgacatgc ... addition of lL 20 lm phenylalanyl-prolyl-arginylchloromethyl ketone (Calbiochem, Darmstadt, Germany) in 20 mm Hepes pH 7.4 containing mm CaCl2 The thermal stability was assessed by incubating activated...
- 15
- 397
- 0
báo cáo khoa học: " Transient effect of weak electromagnetic fields on calcium ion concentration in Arabidopsis thaliana" potx
Ngày tải lên :
12/08/2014, 03:20
... the shielding box: there was no measurable change in the luminescence of the AEQ plants after switching on the EMF, indicating that there is no influence to cytosolic Ca2+-concentrations at the ... intrinsic fluorescence of bovine serum albumin isolation from these solutions and partial characterization of the biologically active fluorescing fraction Biofizika 2000, 45:232-239 Page of (page ... outside the permalloy shielding box with the coils, an influence of the relatively weak MF on the photomultiplier could be excluded, but was nevertheless checked for safeness, as well in the total...
- 9
- 402
- 0
Tài liệu Báo cáo khoa học: Functional effects of deleting the coiled-coil motif in Escherichia coli elongation factor Ts pptx
Ngày tải lên :
21/02/2014, 00:20
... growing cells in glucose/Mops containing different concentrations (20–60 lM) of proline Cloning of EF-Ts and construction of the EF-Ts mutant Wild-type E coli EF-Ts was cloned into expression plasmid ... (underlined) in the MCS (AAGAAGG AGCTCTTCCATGGAATTCCTCGAGGGCTCTTCC TGC) of pAB146 are designed for cloning of genes so that no additional amino acids are introduced into the final protein product Plasmid ... that the coiled-coil motif also plays a central role in controlling the stability of the EF-Tu–EFTs complex In contrast to the enhancing effect of the mitochondrial subdomain N on the strength of...
- 12
- 502
- 0
The Interdepartmental Graduate Concentration in Women’s Health potx
Ngày tải lên :
05/03/2014, 15:20
... Currently, the Interdepartmental Graduate Concentration in Women’s Health will be offered in conjunction with degree programs in the School of Public Health or the College of Nursing are eligible ... Professor, Maternal Child Nursing, UIC CON; Co-Director of Clinical Core, UIC National Center of Excellence in Women’s Health; Coordinator, UIC Midwifery Dorrie W Schwertz, Ph.D., Pharmacology, ... they reflect the ethical foundations of the field These elements are addressed initially in the introductory course to the field of Women's Health Theoretical and methodological aspects of...
- 8
- 531
- 0
the problem of evil the gifford lectures delivered in the university of st andrews in 2003 aug 2006
Ngày tải lên :
10/06/2014, 21:29
... The thesis ‘If the concept of a contingent being is intelligible, the concept of a The Idea of God 31 non-contingent being is intelligible’ seems no more implausible than the thesis ‘If the concept ... accept (or have accepted) the following thesis: There is a certain philosophical or theological problem, the problem of evil, that confronts theists and atheists alike When theists confront the ... overarching problem of evil, the only result would be two people talking past each other What I call the problem of evil’ essentially involves God, and any problem that someone else calls the...
- 198
- 366
- 0
Báo cáo khoa học: " Differential protection by wildtype vs. organelle-specific Bcl-2 suggests a combined requirement of both the ER and mitochondria in ceramide-mediated caspase-independent programmed cell death" docx
Ngày tải lên :
09/08/2014, 10:20
... key role in certain types of ciPCD, as intracellular calcium influx caused by ER stress induces activation of calpains, a family of calcium-dependent cytosolic proteases that can elicit ciPCD [2] ... Bcl-2 constructs with defined subcellular localization in Jurkat cells Transient expression of Bcl-2 constructs with defined subcellular localization in Jurkat cells (A) Schematic representation of ... Similarly, the construct Bcl-2 cb5 (Fig 2A, B) contains the 35 amino acid insertion sequence of the ER-specific isoform of rat hepatic cytochrome b5, directing Bcl-2 to the cytosolic face of the...
- 9
- 388
- 0
Báo cáo y học: " Daily rhythm of salivary and serum urea concentration in sheep" ppt
Ngày tải lên :
10/08/2014, 09:20
... suggest the influence of external stimuli (feeding time) on the rhythmic pattern of metabolites involved in liver function, possibly acting on circadian clocks in the liver and the suprachiasmatic ... Restricted feeding entrains liver clock without participation of the suprachiasmatic nucleus Genes Cells 2001, 6:269-278 Piccione G, Grasso F, Fazio F, Assenza A, Caola G: Influence of different schedules ... according to the single cosinor procedure [12]: Mesor (Midline Estimating Statistic of Rhythm), expressed in the same conventional unit of the relative parameter, with the confidence interval...
- 4
- 426
- 0
báo cáo khoa học: " Characterization of highly efficient heavy-ion mutagenesis in Arabidopsis thaliana" pdf
Ngày tải lên :
11/08/2014, 11:21
... GATGCGATTCAcTCGCTCCAGCT GATGCGATTCA TCGCTCCAGCT C- 162-gl1 AGTGGTCTTcttcgc•••ctccttAGAGTT AGTGGT CTT AGAGTT C( 450)-100-gl1 CATGGATAATTcAGCTCCAGATT CATGGATAATT AGCTCCAGATT C( 450)-135-hy1 AAAACTCAcaa•••cagttcaAGAG ... AAAACTCAcaa•••cagttcaAGAG AAAAC TCA AGAG C( 450)-150-pid1 AACTCCGTTCACCGCGAC AACTCCGTT T CACCGCGAC C( 450)-154-hy1 AACTAAaccgta•••ggtatgGTTCA AACTAA GTTCA C3 0-9-gl2 TGCAGGCTATtCAAAGAGACA TGCAGGCTA T CAAAGAGACA ... CAAAGAGACA C3 0-39-hy1 CATTGAACAggaaaTCCCTTAGC CATTGAAC A TCCCTTAGC C3 0-74-hy1 TTCTTTCTccACACTTGC TTCTTTCT ACACTTGC C3 0-106-gl1 AGTGTACTtCGTGAGAAG AGTGTAC T CGTGAGAAG CTTGGGAAGaGGAGCAATT CTTGGGAAG...
- 35
- 232
- 0
The quest for zhuang identity cultural politics of promoting the buluotuo cultural festival in guangxi china
Ngày tải lên :
09/09/2015, 08:16
... Expo CASS Chinese Academy of Social Sciences CCP Chinese Communist Party CCTV China Central Television CPC Central Committee of the Communist Party of China GASS Guangxi Academy of Social Sciences ... actions The role of local actors as agents in this process of reconstructing culture including recalling memory, restoring the tradition of chanting the worship songs, and incorporating local ... Zhaung were involved in manufacturing discourses about their cultural identities in the context of local politics as well as in the larger international context of China-ASEAN economic development...
- 312
- 1.4K
- 0
báo cáo hóa học:" Effects of alpha-calcitonin gene-related peptide on osteoprotegerin and receptor activator of nuclear factor-B ligand expression in MG-63 osteoblastlike cells exposed to polyethylene particles" doc
Ngày tải lên :
20/06/2014, 04:20
... per unit volume of solution MG- 63 cells The human osteoblast-like MG- 63 cell line (CRL-1427™, ATCC) was obtained from the American Type Culture Collection The cell line was cultured in RPMI 1640 ... each PCR cycle, resulting in the calculation of the threshold cycle or C t value that defines the PCR cycle number at which an exponential growth of PCR products begins PCR cycle conditions were ... DA: Molecular and mechano-biology of collagen gel contraction mediated by human MG- 63 cells: involvement of specific intracellular signaling pathways and the cytoskeleton Biochem Cell Biol 2009,...
- 8
- 411
- 0
báo cáo hóa học:" Effects of alpha-calcitonin gene-related peptide on osteoprotegerin and receptor activator of nuclear factor-B ligand expression in MG-63 osteoblastlike cells exposed to polyethylene particles" pot
Ngày tải lên :
20/06/2014, 07:20
... per unit volume of solution MG- 63 cells The human osteoblast-like MG- 63 cell line (CRL-1427™, ATCC) was obtained from the American Type Culture Collection The cell line was cultured in RPMI 1640 ... each PCR cycle, resulting in the calculation of the threshold cycle or C t value that defines the PCR cycle number at which an exponential growth of PCR products begins PCR cycle conditions were ... DA: Molecular and mechano-biology of collagen gel contraction mediated by human MG- 63 cells: involvement of specific intracellular signaling pathways and the cytoskeleton Biochem Cell Biol 2009,...
- 8
- 367
- 0
Effect of urban emissions on the horizontal distribution of metal concentration in sediments in the vicinity of Asian large cities
Ngày tải lên :
05/09/2013, 09:08
... found for the sampling locations based on the completely fresh water level of chloride ion content smaller than 11 0mg/ L in the samples Table gives the results of metal concentration of the suspended ... mistakes in Hallare’s results taking into account the very small concentration of their reported values for zinc Table Summary of the metal contents of sediments in the Philippines (mg/ kg) Manila Bay ... high concentrations of lead and zinc Table summarizes the results of all the target metals in this study Concentration of metals like copper and nickel other than lead and zinc were distributed in...
- 11
- 440
- 0
Cadmium Removal by the Hydroponic Culture of Giant Reed (Arundo donax) and Its Concentration in the Plant
Ngày tải lên :
05/09/2013, 10:17
... Table - Components of culture broth Component Concentration [mg/ L] (NH4)2SO4 10 Na2HPO4･12H2O 20 KCl 10 CaCl2 MgCl2･6H2O FeCl3 MnCl2･4H2O 0.1 Table - Experimental conditions Initial cadmium conc ... initial concentration of cadmium was set to 1.0 mg/ L and after 55 days, the cadmium concentration was increased to 5.0 mg/ L by extra addition experiment to clarify the concentration of cadmium in the ... Meanwhile, the decreasing rate of the cadmium concentration was higher in early period This is another aspect which is presented in the succeeding discussion with the dynamics of GSH Concentration...
- 7
- 701
- 0
Báo cáo khoa học: Structure of Streptococcus agalactiae serine⁄threonine phosphatase The subdomain conformation is coupled to the binding of a third metal ion pptx
Ngày tải lên :
07/03/2014, 09:20
... methionine: lysine, threonine and phenylalanine at a concentration of 100 lg L) 1 and leucine, isoleucine and valine at a concentration of 50 lg L) 1 Simultaneously, we added selenomethionine at ... modest resolution of the structure, we observed all the coordinating water molecules of the M1 and M2 metal ions, including the water molecule bridging them This water molecule ⁄ hydroxide ion is ... of the flap domain in HsSTP might lead to binding of a third metal ion The implications of the M3 binding and flap subdomain conformations to the catalytic mechanism are discussed below The role...
- 10
- 542
- 0
Báo cáo khoa học: Increased NADPH concentration obtained by metabolic engineering of the pentose phosphate pathway in Aspergillus niger docx
Ngày tải lên :
07/03/2014, 17:20
... (NC4B12-T 7c) 256–272 (NC4B12-T 7c) AARATGGTNCAYAAYGG GTCCAYTTNCCNGTNCC GCAGCTGGACAGCTTCTGCC CGTTCTTGGGCTCAATGGCG GCCATTGATGCCGTCAA CTGGAAAGCCCTGTTGA Degenerate PCR on A niger cDNA a Position in ... for citric acid-producing mycelia [26] Overproduction of 6PGDH resulted in an increase of synthesis of pyridine nucleotide cofactors, as the total pool of these increased Whether the synthesis ... strain (under all conditions) Also the concentration of NADP and NAD had a tendency to be increased in Gnd20, which might counterbalance the regulatory effect of the high NADPH concentration The...
- 13
- 382
- 0
Báo cáo "The effect of Cu concentration in soil and phosphorous fertilizer on plant growth and Cu uptake by Brassia juncea L. grown on contaminated soils " doc
Ngày tải lên :
14/03/2014, 15:20
... reflected the concentration in soil The contents of Cu in plant increase upon the rates of Cu application, especially at the high rate of Cu above 100 ppm It can be said that the increase of ... reduction of plant growth (plant height and biomass of Brassica juncea L. ) with increasing concentration of Cu in soil The accumulation of heavy metal in plant tissues of Brassica juncea L is ... rate of Cu uptake and accumulation in plants is much faster than the decrease of rate of plant growth For example, the contents of Cu in plant increase by 208% when the rate of Cu application increases...
- 5
- 590
- 1
Báo cáo Y học: Irregular spiking in free calcium concentration in single, human platelets Regulation by modulation of the inositol trisphosphate receptors ppt
Ngày tải lên :
17/03/2014, 17:20
... rate of Ca2+ pumping rather than the diffusion of released Ca2+ into the cytosol (as in bigger cells) determines the duration of the platelet spikes In many cell types, the global release of Ca2+ ... desensitized Other factors determining the open probability of the receptor channels are the luminal Ca2+ concentration in the endoplasmic reticulum [9,10], modulation or oxidation of the receptor sulfhydryl ... InsP3, in a way insensitive to heparin and cAMP Puff-like characteristics of [Ca2+]i spiking in single platelets Fig InsP3-induced CICR in permeabilized platelets (A) Traces of InsP3-induced mobilization...
- 10
- 533
- 0
Báo cáo khoa học: Roles of adenine anchoring and ion pairing at the coenzyme B12-binding site in diol dehydratase catalysis pptx
Ngày tải lên :
23/03/2014, 06:20
... aristeromycylcobalamin (carbocyclic analog of AdoCbl) [11,39] The substrate facilitates Co C bond cleavage by inducing conformational changes that increase the steric strain of the Co C bond of enzyme-bound ... 5¢-ggcatccagtcggcaggcaccacggtgatc-3¢ for Kb135A, 5¢-ggcatc cagtcgcaaggcaccacggtgatc-3¢ for Kb135Q, and 5¢-gcatc cagtcggaaggcaccacggtgatc-3¢ for Kb135E, in which underlining indicates amino acid ... as a template The mutagenic sense primers used were 5¢-ctacgccgaaaccatcgccgtctacggcac-3¢ for Sa224A, 5¢-ctacgccgaaaccatcaacgtctacggcac-3¢ for Sa224N, 5¢-ggcatccagtcgagaggcaccacggtgatc-3¢ for...
- 13
- 380
- 0
Báo cáo khoa học: Identification and characterization of the metal ion-dependent L-alanoyl-D-glutamate peptidase encoded by bacteriophage T5 pdf
Ngày tải lên :
30/03/2014, 02:20
... of Micrococcus luteus is A2 (l- lysine in the third position; teichuronic acids instead of teichoic acids); and the cell walls of corynebacteria contain lipids, like those of Gram-negative microorganisms ... enzyme activity, probably because of binding of the chelator Increasing the concentration of magnesium or zinc chloride to 0.5 mm resulted in inhibition of the enzyme There was no inhibition of enzyme ... suspension The reaction was initiated by the addition of a chloride of the corresponding metal The activity was calculated as a percentage of the initial activity, measured in the absence of chelators...
- 14
- 413
- 0
Báo cáo khoa học: Determination of the metal ion dependence and substrate specificity of a hydratase involved in the degradation pathway of biphenyl/chlorobiphenyl pot
Ngày tải lên :
30/03/2014, 15:20
... respective divalent metal salts at 100 mm concentrations: MgCl2, MgSO4, MnCl2, MnSO4, CoCl2, CoSO4, ZnCl2, ZnSO4 and CaCl2 After incubation the samples were assayed for activity in a final volume of ... a catalytic rather than just a substrate binding role Possible roles of the cation include the activation of water for the hydration reaction and ⁄ or the stabilization of the anion transition ... pET28a The bphH gene was amplified by PCR using the primers with the respective sequences 5¢-CCCGCATATGACCCCTGA ACTG and 5¢-CCCCAAGCTTCAGTGAAAGCGCAC NdeI and HindIII restriction sites are underlined...
- 9
- 461
- 0