lakes limnology and limnetic ecology towards a new synthesis

... Lakes and the Baltic Sea, the West Siberian Ice Lake, as 11 Origin of Lake Basins Paratethys Sea Desiccated Mediterranean Basin (a) Aral Sea Caspian Sea Carpathian Lake Black Sea Mediterranean Basin ... subsidiary fault scarps or other structural features may lead to is- 35 land formation They are not common and labelled as structural islands Olkhan Island and the small Ushkani Islands in Lake Baikal ... Victoria (Uganda, Kenya, Tanzania) Geneva (France, Switzerland) Lugano (Italy, Switzerland) Attersee (Austria) Biwa (Japan) Constance (i.e Bodensee Austria, Germany, Switzerland) Maggiore (Italy, Switzerland)...

Ngày tải lên: 15/03/2014, 18:20

... of the Government, namely, National Rural Health Mission (NRHM), Sarva Shiksha Abhiyan (SSA), Total Sanitation Campaign (TSC) and Mahatma Gandhi National Rural Employment Guarantee Scheme (MGNREGS) ... 223 ABBREVIATIONS ANM Auxiliary Nurse Midwife ASHA Accredited Social Health Activist AWCs Anganwadi Centres AWW Anganwadi Worker AWH Anganwadi Helper BDO Block Development Officer CARA Central Adoption ... cruelty, maltreatment, abuse and sexual exploitation and are supported by a strong social safety net The Ministry aspires to facilitate access to culture and arts, recreation and play, leisure and...

Ngày tải lên: 23/03/2014, 06:20

... essentially social historical dramas that find an ancestor in American realism and naturalism of the late nineteenth century I am not arguing here that all cinema was indebted to a realist aesthetic ... are necessarily abstract and tentatively bring together an analysis of The Matrix franchise and Quentin Tarantino’s brand of metacinema I focus on an aesthetics of cinema rather than its politics ... Gump and Scream have each received a significant amount of attention from film and cultural theorists), theory relegates an examination of popular cinema as far from a conventional aesthetic approach...

Ngày tải lên: 19/02/2014, 07:20

Ngày tải lên: 21/02/2014, 01:20

... past and future), mood (indicative and imperative), and voice (active and passive) As concerns notation, usually several kinds of information are collapsed in a single abbreviation, cf K standing ... (which is an adjectival word-ending, ambiguous among nominative and accusative singular masculine-inanimate, and nominative singular masculine-animate, thus representing the adjectival "normal form,'), ... project of man-machine communication called TIBAQ (Text -and- Inference Based Answering of Questions, cf (Haji~ov@ and Sgall, 1981)) with no pre-arranged data base and with the capacity of self-enriching...

Ngày tải lên: 09/03/2014, 01:20

... Denmark Estonia Finland France Georgia Germany Greece Hungary Iceland Ireland Israel Italy Kazakhstan Kyrgyzstan Latvia Lithuania Luxembourg Malta Monaco Netherlands Norway Poland Portugal Republic ... the particular health conditions of the countries it serves Member States Albania Andorra Armenia Austria Azerbaijan Belarus Belgium Bosnia and Herzegovina Bulgaria Croatia Czech Republic Denmark ... Greece Malta Italy Spain Portugal Israel France Switzerland Netherlands Germany United Kingdom Austria Belgium Sweden Denmark Norway Finland Yugoslavia Bulgaria Hungary Romania Slovakia Czech...

Ngày tải lên: 16/03/2014, 14:20

... Coomassie Brilliant Blue (A) and the other was stained for activity using a- naphtyl acetate after renaturation (B) Lane M relative molecular mass standards; lane 1, cell free extract; lane 2, heat-stable ... 5¢-CA FEBS Journal 274 (2007) 2832–2842 ª 2007 The Authors Journal compilation ª 2007 FEBS M Levisson et al GTCACCTGGTAGTTACTGCCGCCGAAG-3¢, 5¢-CGAC GATCTCAATAACTTGATGATTTCAGG-3¢ and 5¢-CTC CTGAAATCATCAAGTTATTGAGATCGTCG-3¢, ... Quickchange (Stratagene) site-directed mutagenesis with the following primers 5¢-GT GCTGGGACACGCCCTCGGTGCGATGC-3¢ and 5¢-GC ATCGCACCGAGGGCGTGTCCCAGCAC-3¢, 5¢-GATCT TCGGCGGCAGAAACTACCAGGTGACTG-3¢ and...

Ngày tải lên: 23/03/2014, 09:20

... Serological methods Rabbit antisera against Citrobacter strains PCM 1531 and PCM 1487 were prepared as described previously [21] Passive haemagglutination and inhibition of passive haemagglutination ... Romanowska, A. , Gamian, A. , Witkowska, D., Katzenellenbogen, E & Romanowska, E (1994) Serological and structural features of Hafnia alvei lipopolysaccharides containing D-3hydroxybutyric acid ... Fuc and 3-substituted Rha in the molar ratio  : These data suggest that the OPS-I and OPS-II have an identical branched tetrasaccharide repeating unit It consists of the main chain containing...

Ngày tải lên: 23/03/2014, 17:22

... Slovakia a TFYR Macedonia Hungary Croatia Bulgaria Kazakhstan Georgia Turkmenistan Albania Romania Azerbaijan Belarus Armenia Republic of Moldova Kyrgyzstan Uzbekistan 50 100 150 200 250 300 Availability ... Estonia Norway United Kingdom Poland Italy Romania Czech Republic Malta Denmark Latvia Portugal Ukraine Slovenia Bulgaria Russian Federation Slovakia Kyrgyzstan Spain Kazakhstan Turkmenistan Hungary ... both the total quantity eaten and the variety and choice have changed remarkably over the last 50 years Similar changes and differences apply to the availability of milk fat and fish (according...

Ngày tải lên: 28/03/2014, 23:20

... the lactococcal dehydrogenases and ADH of yeast and horse liver as a function of the ATP and ADP pool Criterion for all data points chosen: [ATP] > [ADP] (A) Dehydrogenases from Lactococcus lactis ... 6-phosphate dehydrogenase by adenosine 5Â-triphosphate Proc Natl Acad Sci USA 56, 15431547 Nakamura M, Fujiwara A, Yasumasu I, Okinaga S & Arai K (1982) Regulation of glucose metabolism by adenine ... different manner than GAPDH Inhibition of LDH and ADH is competitive for ATP, ADP and AMP, whereas inhibition of GAPDH by ATP, ADP and AMP appeared to be mixed However, the high dissociation constants...

Ngày tải lên: 29/03/2014, 08:20

... Bahrain, Liberia and Seychelles in Africa; and the Cook Islands, Maldives, the Marshall Islands, Nauru, Niue, Samoa, Tonga and Vanuatu in Asia; as well as economies in the Caribbean such as Anguilla, ... Denmark, Estonia, Finland, France, Germany, Greece, Hungary, Ireland, Israel, Italy, Japan, Latvia, Lithuania, Luxembourg, Malta, the Netherlands, New Zealand, Norway, Poland, Portugal, Romania, ... Anguilla, Antigua and Barbuda, Aruba, Barbados, Belize, the British Virgin Islands, the Cayman Islands, Dominica, Grenada, Montserrat, the Netherlands Antilles, Panama, Saint Kitts and Nevis, Saint...

Ngày tải lên: 30/03/2014, 12:20

... chamois, and valuable birds (peafowl, parrots, hill minas, and cochins), and reptiles (pythons, snakes, varans, and tortoises) Beautiful and famous landscapes: The natural rocky mountain system in Van ... villages + By the number of trades: villages of a trade and villages of many trades + By nature of trades: Traditional trade villages and New trade villages * Traditional trade villages Basing ... but also conserves national cultural and historical values Developing economy and society in a sustainable way in trade villages is a new direction and a major challenge for many trade villages...

Ngày tải lên: 20/04/2014, 17:13

... Republic of China Author details Department of Mathematics, Honghe University, Yunnan, 661100, China 2Department of Mathematics, National Kaohsiung Normal University, Kaohsiung 824, Taiwan Authors’ ... YF, Shang, MJ, Qin, XL: An iterative method of solution for equilibrium and optimization problems Nonlinear Anal 69, 2709–2719 (2008) doi:10.1016/j.na.2007.08.045 Tada, A, Takahashi, W: Weak and ... equilibrium problems and fixed point problems: A new iterative method, some comments and applications Fixed Point Theory and Applications 2011 2011:33 Submit your manuscript to a journal and benefit from:...

Ngày tải lên: 21/06/2014, 01:20

... contribution AF and LC coordinated the study Data acquisition and data analysis were done by AC, EV, GN, AF The manuscript was prepared by LC and GN All authors read and approved the final manuscript ... for AAA can be found in Fogliata et al [6] In summary, the AAA configuration phase consisted in the optimisation of parameters and calculation kernels against the measured beam data The optimisation ... for beam characterisation and modelling into the treatment planning system, periodic quality assurance tests and RapidArc operations In all areas, UNIQUE resulted meeting specifications and having...

Ngày tải lên: 09/08/2014, 09:21

... available); PAL5-F, 5’TTTCTCCATTACAAATCAAACCA-3’ and PAL5-R, 5’-TTCACTTCATCCAAATGACTCC-3’, CHS2 LOC778295 (7794); DFR LOC544150 (7795); FLS-F, 5’TAAGATTTGGCCTCCTCCTG-3’ and FLS-R, 5’ACCAAGCCCAAGTGATAAGC-3’; ... to make the primer 75ALerevECO (GGAATTCTCAGCAACGATAAACGTCCAAAGATAG) with an additional EcoRI site for the 3’ end of the gene The 5’ end primer, 75ALedirBAM (GGGATCCATGGCGTTACGTATTAATGAGTTATTT), ... 5’ACCAAGCCCAAGTGATAAGC-3’; F3H-F, 5’AGTGGTGAATTCGAATAGCAGTAG-3’ and F3H-R, 5’-TTTCCTCCTGTACATTTCTGCAA-3’; F3’H-F, 5’GAGGAGTTCAAGTTAATGGTGGT-3’ and F3’H-R, 5’-ACTCGCTTTTCCTTGTGTTCTT-3’; ANT1 (7793); JAF13-F,...

Ngày tải lên: 12/08/2014, 03:21

... visual-analogue scales (range 0–100%) This documentation is again mandatory and must be marked on the laboratory form (Fig 1) In the intervention arm, blood or tracheal aspirate specimens are analyzed ... measurements of IL-8 and G-CSF and tracheal aspirate levels of G-CSF, employing a new laboratory method that allows simultaneous determination of parameters from 50 µl blood or tracheal aspirate ... Clinical data record form A trained study nurse collects all relevant clinical data for the day before and until days after collection of blood and/ or form tracheal aspirate for microbiological examination...

Ngày tải lên: 12/08/2014, 20:20

... numerical tools and carried out the numerical analysis and the third CG has suggested and analyzed the applicative context of the paper Acknowledgements We wish to acknowledge the support of a Lagrange ... dimensionality and both input energy and metabolism are proportional to y In U2, as we have seen, the energy input term has a fractal dimensionality In U3, one more term with a fractal exponent, again ... al suggest a dynamical evolution of p in the transition from an avascular phase to an angiogenetic stage in tumors [13] Equation (7) may have (as in Refs [1] to [6]) a very simple energy balance...

Ngày tải lên: 13/08/2014, 16:21

... 16) at t2 The Tanzanian and German board of the organization managing the orphanage gave their consent and ethical approval Materials The interview sets were basically identical for both assessments ... Childhood adversity, mental illhealth and aggressive behavior in an African orphanage: Changes in response to trauma-focused therapy and the implementation of a new instructional system Child and Adolescent ... at home and school in Tanzania [20] To date no prevalence rates for Tanzania are available [20], but Straus [17] reported that more than two thirds of Tanzanian students did not strongly disagree...

Ngày tải lên: 13/08/2014, 18:22

... on his desk and a dictionary mounted on a stand There was a stock-exchange ticker with a glass dome over it, an electromechanical calculating machine that you cranked by hand, and a couch on which ... mortgage crash in 2007, Asness’s firm, AQR Capital Management, was running a remarkable $38 billion and Asness himself personified the new globe-changing finance He was irreverent, impatient, and scarcely ... hedge funds wreaked havoc with exchange-rate policies in Europe and Asia After the East Asian crisis, Malaysia’s prime minister, Mahathir Mohamad, lamented that “all these countries have spent 10...

Ngày tải lên: 01/11/2014, 21:26

... The Stability and Growth Pact (co-authored) The Global Crash Towards a New Global Financial Regime? Leila Simona Talani 10.1057/9780230281530 - The Global Crash, Edited by Leila Simona Talani Copyright ... infinitesimally small probability and statistical distributions with fat tails that have become so fatal when the financial markets took a general downturn In the Keynesian/informational paradigm uncertainty ... create new financial products and later on gave a favourable rating to the same products Their incentives, instead of leading to the creation of sound and safe financial products, were skewed towards...

Ngày tải lên: 01/11/2014, 23:25