krouse brand name as a barrier to entry the realemon case

... (female), patient As many men fail to abide by what is expected of an ART patient, at least until they are more comfortable with their new identity as an ART user and have adopted a more ART-friendly ... to a hegemonic masculine sexuality A man who engages in extra-marital sexual relationships and gets an embarrassing disease like HIV is perceived to have a weak, diseased, compromised, laughable ... guilty and embarrassed about their extra-marital affairs when having multiple girlfriends is one way to demonstrate their masculinity, it appears that a healthy sexuality is intrinsically linked to...

Ngày tải lên: 11/08/2014, 14:21

... GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) (N ¼ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) for amplification of pyk The resulting PCR ... phosphate isomerase, UÆmL)1 glycerol 3-phosphate dehydrogenase and 0.3 U aldolase PK was assayed as described by Crow and Pritchard [30] Final concentrations in assay was: mm GDP, mm PEP, mm fructose ... (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4 (5¢-CTAGTCTAGATGAGCTCCAGAAGCTTCC-3¢) were amplified The PCR products were digested with XhoI ⁄ BamHI and BamHI ⁄ XbaI, respectively, and cloned...

Ngày tải lên: 19/02/2014, 17:20

... properties of the lipid phase [35] The mechanisms highlighted above conceivably also operate in the present case The heat-induced activation of kinases such as Akt has been shown to increase HSF1 activity ... Enhanced Ras maturation by heat stress was associated with a heightened activation of extracellular signal-regulated kinase (ERK), a key mediator of both mitogenic and stress signaling pathways, ... Immediately after treatment, the cells were cooled to °C and lysed Luciferase activity was measured as described in [48] Statistical analysis All data are expressed as mean ± SD Student’s paired...

Ngày tải lên: 07/03/2014, 12:20

... The responsibility of the scientists is to screen  among these alternatives the feasible measures  based  on  applicability  and  suitability  for  the local conditions.   2.4. Evaluation criteria   After the problem and its constraints have  ... and  accounts  for  75%  to 85%  of  the total  yearly  rainfall,  whereas  the dry  season  lasts  up  to 6  months,  from  February  to July  and occupies only 15‐25% of the total rainfall.   ... on  diseases.  Finally,  the impact  and  area  of  impact  are  important  for  the aquaculture,  agriculture,  industries  and  other  land  users.  Based  on  these  criteria  and  the preference ...

Ngày tải lên: 22/03/2014, 12:20

... emphasis away from linkage analysis and microsatellite markers towards SNP genotyping and different analytical strategies based on association and haplotype analysis [31–34] Association analyses are ... Several useful SNP databases are available on the World Wide Web (see Table 1); these databases are constantly updated and are growing rapidly However, the data contained in them are far from infallible ... Sasaki S, Adra CN, Kitaichi M, Inoue H, Yamauchi K, Tomichi N, Kurimoto F, Hamasaki N, Hopkin JM, Izuhara K, Shirakawa T, Deichmann KA: Genetic variants of IL-13 signalling and human asthma and...

Ngày tải lên: 12/08/2014, 18:20

... respect to the Japanese: A guide for Americans InterAct series Yarmouth, Me: Intercultural Press, 1984 [15] V LoCastro, Intercultural pragmatics A JapaneseAmerican case study Lancaster [England]: ... the target language in appropriate ways to convey meanings, CLT is unsuitable for Asian learners because this approach would not help them to pass the traditional national examinations, which ... cultural variation in learning, maybe our most important task as Western teachers is to learn about the particular pedagogy of our students’ home cultures and adapt their teaching to the learning...

Ngày tải lên: 24/06/2015, 08:16

... propriety assets According to him, Brand loyalty has to with the level of devotion a consumer has to a brand Brand awareness has to with the ability of a potential buyer to identify a brand among a product ... that firm’s customers” Brand loyalty Aaker (1991 p.39) defined Brand loyalty as the attachment that a customer has to a brand It can also be seen as consumer’s preference to purchase a particular ... consumer’s basedbrand equity namely brand awareness, brand image, perceived quality and brand loyalty Among the three dimensions, brand loyalty appears to have the least brand equity rating by consumers...

Ngày tải lên: 24/09/2012, 17:19

... of the American Medical Association Influenza was not a reportable disease: the only evidence of the early occurrence was the registration of deaths reported as uncomplicated cases of pneumonia ... on the transmission disease There are two major classes of influenza virus, type A and B these two classes have similar structures, but all A virus proteins are different from B as far as the ... change to that of a respiratory airborne-virus that is adapted to the mammalian lung? Second, the viruses must adapt to environmental changes, able to withstand temperate, moisture and ph changes...

Ngày tải lên: 02/11/2012, 11:12

... this approach in their teaching But the fact is that they have not successfully applied this approach Half of them say that they always let their pupils make questions communicatively in class and ... questions These are questions that give suggestion to make students contribute their own ideas, their information, their available knowledge and basing on that the learners can understand the lesson and ... which the questioner already knows For example, when teacher asks students for information that is in the text, and the teacher has already read the text and knows the answers, those are display...

Ngày tải lên: 27/12/2013, 20:26

... Q279E a- galactosidase A residual activity in patient derived cells; thus, galactose was demonstrated to be first active-site-directed pharmacologic chaperone for a lysosomal storage disease Galactose ... a- galactosidase A variants (causing another lysosomal storage disease) were shown to be folding and trafficking mutants [16] before this was explored as a possibility in GD Galactose administration increased ... fraction that does localize properly only has fractional glucosylceramide hydrolase activity That said, the fractional activity appears to be sufficient to ameliorate disease, when folding and trafficking...

Ngày tải lên: 18/02/2014, 16:20

... treated in a fair and friendly manner, graciously and courteously •  That you want to help them •  To see you as the solution to their problem, and not be seen as your problem •  To be treated as ... sales are made on the first contact 3% of sales are made on the second contact 5% of sales are made on the third contact 10% of sales are made on the fourth contact 80% of sales are made on the ... withdraw/ avoid dictate/ assert attack/ be sarcastic Seeks attention accuracy productivity recognition Likes you to be pleasant precise to the point stimulating Wants to be liked correct in charge...

Ngày tải lên: 19/02/2014, 14:20

... important to ascertain how much language they are using at home If necessary use a bilingual worker to talk with the family and establish what language the child speaks at home, ask the family ... professionals make clear the behavioural and language expectations for the learners The way the games are organised and the support provided assists the learners to take part using the comprehension and ... of factors make a difference to the way children approach the learning of a second language and their ability to interact with others These factors include: • social factors – some children are...

Ngày tải lên: 24/02/2014, 18:20

... b-Actin GAAGAAGGGCCAGACGC CCTTCGCTGAGTTCCTGC ACATCAGCGGATACTACAGAG TTTGAATGGGCGAGTGATTG CGGAAACGCCTTAAGTCCAG AATAAGCTTCCGACTCTAGCCGC AGCTGGTGCAGGAGGAAGTA CCGAGAACCGAACTTACCAA AGGAAGCACCCAGCAATACCA ... AGGAAGCACCCAGCAATACCA CACCTTGGATGGGTATTCCA CACAGCTCCCATTCATTCCA TCCTCCCTGGAGAAGAGCTA CTCCTGGGACACGATGC CTGCGGTGCTGTTGTGG CACCATCATAAGGGTAAACAT ACAGCAAAAAGGAGGCCAAA GCCACAATCCAGTCATTCCA GATAAGCTTGTGGAAGTCGCGT ... activation of caspase shown was calculated from the average of three experiments Each value is expressed as ratio of caspase activation level to untreated level, and the untreated level was set to *versus...

Ngày tải lên: 06/03/2014, 22:21

... SRSD To achieve the goals, a 6-stage procedure for SRSD is adapted from the literature on SRSD (e.g Graham and Harris [19]; Mason, Harris and Graham [18]; Harris, Graham and Mason [20]; Chalk, Hagan-Burke ... The evaluation is internal, i.e evaluating the task against the stated objectives/goals - Evaluators: The teacher and the students directly involve in evaluating the task - Timing: The evaluation ... Department The material is used as a resource rather than a script The teacher is going to examine it to see what learning opportunities it provides and design a curriculum that can add value to the tasks...

Ngày tải lên: 28/03/2014, 11:20

... Esposito and I Caputo 132 Akagi A, Tajima S, Ishibashi A, Matsubara Y, Takehana M, Kobayashi S & Yamaguchi, N (2002) Type XVI collagen is expressed in factor XIIIa+ monocyte-derived dermal dendrocytes ... formation has been implicated in such diseases as liver, renal 620 C Esposito and I Caputo and pulmonary fibrosis, as well as atherosclerosis [66] It is noteworthy that TG2 activity is increased and ... coagulation cascade The A subunit of coagulation FXIII (an FXIII A dimer) has been identified in the cytoplasm of platelets, megakaryocytes and monocytes–macrophages [2,3] FXIIIA catalyses the crosslinking...

Ngày tải lên: 30/03/2014, 15:20

... FA, Ventura JL, Casas M, Casas H, Pages T, Rama R, Ricart A, Palacios L, Viscor G: Erythropoietin acute reaction and haematological adaptations to short, intermittent hypobaric hypoxia Eur J Appl ... hypobaric chamber stay (90 min) and the other in the second 90-min period of stay The protocol of OME was the same as HME and also took place into the hypobaric chamber; however, as the door was ... and/or assembly of data, data analysis and interpretation, manuscript writing; RS: data analysis and interpretation, manuscript writing All authors read and approved the final manuscript Additional...

Ngày tải lên: 18/06/2014, 15:20

... type diabetes subjects Immunogenetics 2010, 62:101-107 36 Kawasaki E, Awata T, Ikegami H, Kobayashi T, Maruyama T, Nakanishi K, Shimada A, Uga M, Kurihara S, Kawabata Y, et al: Genetic association ... Cobbold S, Alyanakian MA, Gouarin C, Barriot S, Garcia C, Waldmann H, Bach JF, Chatenoud L: Autoimmune diabetes onset results from qualitative rather than quantitative age-dependent changes in pathogenic ... remains to be assessed One potential limitation of the process is the identification of those antigens that are the most relevant as targets, as the human auto-antigen-specific T cell repertoire...

Ngày tải lên: 18/06/2014, 16:20

... oncological practice and in clinical trials, to the extent that bone metastases are often regarded as a non-measurable disease [4] Criteria exist which use radiographic changes to measure response ... K, Nakajima H, Miyazaki T, Yayama T, Kawahara H, Kobayashi S, Tsuchida T, Okazawa H, Fujibayashi Y, Baba H: Effects of Alendronate on bone metabolism in glucocorticoid-induced osteoporosis measured ... performed as a pilot substudy of an open-label phase trial of Alpharadin in patients with bone metastases and castration-resistant prostate cancer Repeated 18F-fluoride PET imaging, PSA and ALP assessments...

Ngày tải lên: 21/06/2014, 02:20

... program ti due to i l t f data in Software Attacks: • Intentionally launched malicious programs enable the attacker to use the computer in an unauthorized manner • General Categories: • Viruses and ... the anti-virus software’s request to read the file and passing the request to the virus, instead of the OS The virus can then return an uninfected version of the file to the anti-virus software, ... Create Computer Viruses Virus writers can have various reasons for creating and g spreading malware Viruses have been written as: • • • • • • • • • Research projects Pranks Vandalism To attack the...

Ngày tải lên: 31/07/2014, 04:20