kinases protein kinase c protein kinase a pkc pka inhibits the tail domain phosphorylation by pdks

Báo cáo khoa học: Inactive forms of the catalytic subunit of protein kinase A are expressed in the brain of higher primates potx

Báo cáo khoa học: Inactive forms of the catalytic subunit of protein kinase A are expressed in the brain of higher primates potx

Ngày tải lên : 30/03/2014, 04:20
... TGCCATGAAGATCTTAGA TGAGCAGTACTACGCCATGA GTAGCCCTGCTGGTCAATGA TTCCGTAGAAGGTCCTTGAG (VII) TTCCGTAGAAGGTCCTTGAG (VII) CCTAATGCCCACCAATCCA (VI) TTCCGTAGAAGGTCCTTGAG (VII) TTCCGTAGAAGGTCCTTGAG (VII) CTAATCTATGAAATGGCAG ... human human Rhesus monkey mouse Lower primer (5¢- to 3¢) CGGGAACCACTATGCC ACACAAAGCCACTGAA (V) CCCTTCTTGCCATCG (I) GCCGGTTATTTCATAGACAC (II) AAGACGTTTAGGTGCAAT (III) CCCTTTGCTGTTGGAT (IV) TGCCATGAAGATCTTAGA ... to clone the different Cb splice variants (Pfu Ultra system; Stratagene) Upper primer 5¢-CACCGCCG CCACCATGGGATTGTCACGCAAATCATCAGATGC ATCT-3¢ and lower primer 5¢-TTAAAATTCACCA AATTCTTTTGCACATT-3¢...
  • 13
  • 344
  • 0
Computational studies of host pathogen protein protein interactions   a case study of the h sapiens m  tuberclulosis H37RV system

Computational studies of host pathogen protein protein interactions a case study of the h sapiens m tuberclulosis H37RV system

Ngày tải lên : 10/09/2015, 09:08
... gene pairs, and Jaccard coefficient among three representative databases Table showing data overlap for same chosen pathways in difference source databases This table shows the calculation ... Host-pathogen interaction integration and analysis databases Host-pathogen interaction integration and analysis databases mainly integrate hostpathogen interaction data from other source databases ... genomicscentric relational database for infectious-disease research(Gillespie et al., 2011) Com- CHAPTER INTRODUCTION AND BACKGROUND 29 prehensive bacterial genomics data, associated data relevant...
  • 211
  • 310
  • 0
Tài liệu Báo cáo khóa học: The PAS fold A redefinition of the PAS domain based upon structural prediction ppt

Tài liệu Báo cáo khóa học: The PAS fold A redefinition of the PAS domain based upon structural prediction ppt

Ngày tải lên : 19/02/2014, 12:20
... PACannotated A thaliana proteins contain a PAS domain Therefore, in the case of A thaliana, the PAS and PAC motifs are inseparable, indicating that the annotation of these proteins as containing only PAS ... models Name Arabidopsis thaliana Adagio Hypothetical 69.1 kDa protein Clock-associated PAS protein ztl Fkf1 (adagio 3) Escherichia coli Hypothetical protein yegE Aerotaxis receptor Caenorhabditis ... whether the best template for modelling a particular PAS domain is related to the cofactor which it contains Unfortunately, there are insufficient PAS domains characterized at the biochemical...
  • 11
  • 592
  • 0
The Project Gutenberg eBook, A Busy Year at the Old Squire''''s, by Charles Asbury Stephens doc

The Project Gutenberg eBook, A Busy Year at the Old Squire''''s, by Charles Asbury Stephens doc

Ngày tải lên : 28/06/2014, 17:20
... was a new departure in Maine farming Cream-separators were as yet undreamed of A water-creamery with long cans and ice was then used for raising the cream; and that meant an icehouse and the cutting ... as a good one, and enjoyed a considerable popularity for a time But practically this was soon found to be a clumsy and inadequate form of speech, also that many other drawbacks attended its adoption ... universal language? Why not have a colloquial, every-day Latin, such as the Romans used to speak in Italy? In point of fact, Latin was the universal language with travelers and educated people all...
  • 860
  • 461
  • 0
The Project Gutenberg eBook, A Busy Year at the Old Squire''''s, by Charles Asbury Stephens pdf

The Project Gutenberg eBook, A Busy Year at the Old Squire''''s, by Charles Asbury Stephens pdf

Ngày tải lên : 28/06/2014, 17:20
... was a new departure in Maine farming Cream-separators were as yet undreamed of A water-creamery with long cans and ice was then used for raising the cream; and that meant an icehouse and the cutting ... as a good one, and enjoyed a considerable popularity for a time But practically this was soon found to be a clumsy and inadequate form of speech, also that many other drawbacks attended its adoption ... universal language? Why not have a colloquial, every-day Latin, such as the Romans used to speak in Italy? In point of fact, Latin was the universal language with travelers and educated people all...
  • 860
  • 304
  • 0
A Short Account of the History of Mathematics, by W. W. Rouse Ball pot

A Short Account of the History of Mathematics, by W. W. Rouse Ball pot

Ngày tải lên : 28/06/2014, 19:20
... Damascius Eutocius Roman Mathematics Nature and extent of the mathematics read at Rome Contrast between the conditions at Rome and at Alexandria End of the Second Alexandrian School ... extant specimens of these almanacks are defective and, in many respects, inaccurate The only geometrical theorem with which we can be certain that the ancient Chinese were acquainted is that ... is to the Athenian schools that we owe the next great advance in mathematics 27 CHAPTER III the schools of athens and cyzicus.1 circ 420 b .c. –300 b .c It was towards the close of the fifth century...
  • 466
  • 529
  • 0
Báo cáo y học: "A network perspective on the evolution of metabolism by gene duplication" pdf

Báo cáo y học: "A network perspective on the evolution of metabolism by gene duplication" pdf

Ngày tải lên : 14/08/2014, 17:22
... MetaCyc EcoKegg EcoCyc Ref Kegg MetaCyc EcoKegg EcoCyc MetaCyc EcoKegg EcoCyc Ref Kegg MetaCyc EcoKegg V EcoCyc } Ref Kegg E5' E5 MetaCyc EcoKegg { E3' } EcoCyc IV E2' E3 CoA R ACP | CH | CH EC:2.3.1.41 ... ana(EcoKegg,hubs .by ECthe amino-acid sequences ofdatabases Reconstructed metabolicamino-acidvariouscriteriathischemical Additionalretention1of duplicates infromthe eliminatingwork graddata duplicates ... paper Additional data file shows the reconstructed metabolic networks from various databases (EcoKegg, EcoCyc, RefKegg and MetaCyc), eliminating hubs gradually in each database Additional data...
  • 10
  • 436
  • 0
A bourdieuvian analysis of the use of singlish by youths in singapore

A bourdieuvian analysis of the use of singlish by youths in singapore

Ngày tải lên : 16/10/2015, 15:35
... which economic capital is only one There is also sociocultural capital, symbolic capital and so on One of the most significant characteristics of fields is the capacity for one form of capital ... values attached to each pole of orientation, which speakers can then draw on Values such as camaraderie, informality, closeness, community membership and crucially, socio-cultural capital are linked ... official language, a language of education, a working language, a lingua franca, (a language for) the expression of national identity and an international language” (p.74) The paramount concern of the...
  • 126
  • 912
  • 0
A text analysis of “the 2007 commencement speech by bill gates at harvard university ” and “the 2014 commencement speech by bill and melinda gates at stanford university” on the de beaugrande framework

A text analysis of “the 2007 commencement speech by bill gates at harvard university ” and “the 2014 commencement speech by bill and melinda gates at stanford university” on the de beaugrande framework

Ngày tải lên : 25/06/2016, 20:56
... information about data collection procedure Chapter III: The analysis of two speeches on De Beaugrande framework This chapter analyzes the collected data then withdraws the final conclusions of the ... and recorded textual units that fulfil the characteristic functions of texts They are cohesive according to Polish grammatical standards and coherent; the texts activate cognitive processes among ... of a text in a discrete sociocultural context in a real time and place Situationality ―concerns the factors which make a text relevance to a situation of occurrence‖ (De Beaugrande and Dressler,...
  • 71
  • 603
  • 0
Tài liệu Báo cáo khoa học: The Arabidopsis protein kinase Pto-interacting 1-4 is a common target of the oxidative signal-inducible 1 and mitogen-activated protein kinases docx

Tài liệu Báo cáo khoa học: The Arabidopsis protein kinase Pto-interacting 1-4 is a common target of the oxidative signal-inducible 1 and mitogen-activated protein kinases docx

Ngày tải lên : 14/02/2014, 19:20
... 5-GACGAGATTATC AGATTTTACGC-3 and 5-AACTGGTGAAGCGGAAG AGAC-3, PTI1-4 (At2g47060): 5-CCCCAAAGAAAATG AGTTGCT-3 and 5-GCATCATTTCCTGGAGGAAAG-3 Acknowledgement This project was supported by grants from the Austrian ... protein kinase C [8] However, the AGC VIII kinases represent a plant-speci c subfamily characterized by a conserved DFD amino acid motif in subdomain VII of the catalytic domain and by the presence ... the ACTIN2 gene as an internal standard PCRs were performed using the following primers: ACT2 (At3g18780): 5-ACATTGT GCTCAGTGGTGGA-3 and 5-CTGAGGGAAGCAAG AATGGA-3, OXI1 (At3g25250): 5-GACGAGATTATC...
  • 11
  • 700
  • 0
Tài liệu Báo cáo Y học: Enhancement by a-tocopheryl hemisuccinate of nitric oxide production induced by lypopolysaccharide and interferon-c through the upregulation of protein kinase C in rat vascular smooth muscle cells docx

Tài liệu Báo cáo Y học: Enhancement by a-tocopheryl hemisuccinate of nitric oxide production induced by lypopolysaccharide and interferon-c through the upregulation of protein kinase C in rat vascular smooth muscle cells docx

Ngày tải lên : 22/02/2014, 04:20
... inhibitory effect of a- T was mediated by a nonantioxidative reaction a- T was reported to decrease PKCa activity due to activation of protein phosphatase 2A (PP 2A) in smooth muscle cells [2– 6] These studies ... apoptosis in hepatopoietic and cancer cell lines is caused by the prevention of PKC activity due to activation of PP 2A, similar to a- T activation of PP 2A [13] The reason for the inconsistency between ... from the Japanese Society for the Promotion of Science, and in part by a research grant from the Faculty of Pharmaceutical Sciences, The University of Tokushima REFERENCES Traber, M.G & Packer,...
  • 6
  • 494
  • 0
Tài liệu Báo cáo khoa học: Phosphorylation of hormone-sensitive lipase by protein kinase A in vitro promotes an increase in its hydrophobic surface area ppt

Tài liệu Báo cáo khoa học: Phosphorylation of hormone-sensitive lipase by protein kinase A in vitro promotes an increase in its hydrophobic surface area ppt

Ngày tải lên : 18/02/2014, 11:20
... 2009 The Authors Journal compilation ª 2009 FEBS C Krintel et al product obtained using the sense primer 5¢-ATC ATC TCC ATC GAC TAC TCC CTG-3¢, the antisense primer 5¢-AAG AAT TCT AGA TTA ATG ... upon phosphorylation by PKA Thus, it can be speculated that phosphorylation of HSL by PKA induces a conformational change that exposes and ⁄ or increases the lipid-binding area of the enzyme A direct ... the inhibition of TO activity by bis-ANS was decreased upon phosphorylation A possible explanation for this apparent discrepancy could be that PKA phosphorylation induces a conformational change...
  • 11
  • 562
  • 0
Tài liệu Báo cáo khoa học: Mitochondrial targeting of intact CYP2B1 and CYP2E1 and N-terminal truncated CYP1A1 proteins in Saccharomyces cerevisiae ) role of protein kinase A in the mitochondrial targeting of CYP2E1 pdf

Tài liệu Báo cáo khoa học: Mitochondrial targeting of intact CYP2B1 and CYP2E1 and N-terminal truncated CYP1A1 proteins in Saccharomyces cerevisiae ) role of protein kinase A in the mitochondrial targeting of CYP2E1 pdf

Ngày tải lên : 18/02/2014, 16:20
... mitochondria-targeting signals, and the precise mechanisms by which these proteins are translocated to the mitochondrial compartment remain unclear [35,36] The mitochondrial inner membrane-associated carrier protein, ... Zgoda VG, Murray BP & Correia MA (2005) Vacuolar degradation of rat liver CYP2B1 in Saccharomyces cerevisiae: further validation of the yeast model and structural implications for the degradation ... reaction was initiated by the addition of mm NADPH, and continued for 30 at 37 C in a shaking water bath The reaction was terminated by the addition of 250 lL of ice-cold 10% trichloroacetic acid...
  • 16
  • 650
  • 0
Tài liệu Báo cáo khoa học: Endogenous expression and protein kinase A-dependent phosphorylation of the guanine nucleotide exchange factor Ras-GRF1 in human embryonic kidney 293 cells pptx

Tài liệu Báo cáo khoa học: Endogenous expression and protein kinase A-dependent phosphorylation of the guanine nucleotide exchange factor Ras-GRF1 in human embryonic kidney 293 cells pptx

Ngày tải lên : 19/02/2014, 18:20
... gene-speci c primers: ON357, 5¢-TGAAACATCACCAACTAAATC TCCAA-3¢; ON358, 5¢-GACGACTCCATTGTTATAGG AAAAGAGT-3¢; ON359, 5¢-GCCGCTGGAGAAACAG CAT-3¢; ON360, 5¢-GCCACCCATTCGTCACAATC-3¢; and ON361, 5¢-ATGCAGAAGGGGATCCGG-3¢ ... coiled-coil, and IQ domains of the exchange factor Ras-GRF act cooperatively to facilitate activation by calcium Mol Cell Biol 16, 4888–4896 33 Arozarena I, Matallanas D & Crespo P (2001) Maintenance ... Biotechnology (Rockford, IL, USA), and the BC assay protein quantification kit was from Uptima (Monticon, France) BAPTA-AM was from Calbiochem (La Jolla, CA, USA) Plasmids The pcDNA3.1(–) vector (Invitrogen),...
  • 13
  • 730
  • 0
Báo cáo khóa học: SUT2 is a novel multicopy suppressor of low activity of the cAMP/protein kinase A pathway in yeast docx

Báo cáo khóa học: SUT2 is a novel multicopy suppressor of low activity of the cAMP/protein kinase A pathway in yeast docx

Ngày tải lên : 07/03/2014, 15:20
... 5¢-TTCACGATTGAACAGGTAAACAAAATTTTCC CTTTTTAGAACGACATGCAGCTGAAGCTTCGTA CGC-3¢ and disRAS1rev CAAAACCATGTCATAT CAAGAGAGCAGGATCATTTTCAACAAATTATGC ATAGGCCACTAGGGATCTG-3¢ YEp351-SUT2 was constructed to contain ... using the primers SUT-GFPfwd 5¢-GACTGTCGATGATTATGGTTGCC CGCTGGCTTCCAAACCCTTATCGATACCGTCGA CCC-3¢ and SUT-GFPrev 5¢-AACAATTTCACACACA GGAAACAGCTATGACCATGATTACGCTATAGG GCGAATTGGGTA-3¢, respectively ... amplified from the plasmid pUG27 [13] using the primers disSUT2fwd 5¢-TGACGCTCACCAAGCTATTGGTTT GTTTGGATCAATCGTCAGATATGAAGGCATAG GCCACTAGTGGATCTG-3¢ and disSUT2rev 5¢-TAT TAATATTCCTATATTTTACATAGGAGGAAATTA...
  • 8
  • 485
  • 0
Báo cáo khoa học: Inhibition of the NF-jB transcriptional activity by protein kinase A pot

Báo cáo khoa học: Inhibition of the NF-jB transcriptional activity by protein kinase A pot

Ngày tải lên : 08/03/2014, 10:20
... immunodeficiency virus long-terminal repeat (HIV-LTR) The jB sequence used was forward (5¢-TTTCTAGGGACTTTCCGCCTGGGGACTTTCCAG-3¢) and complement (5¢-TTTCTGGAAAGTCCCCAGGCG GAAAGTC CCTAG-3¢) The EMSA was ... pCMV-PKAc (C) Activation of CREB-dependent gene expression by PKAc Jurkat cells were transfected with 100 ng of pCRE-luc and various amounts of pCMVPKAc The data are presented as the fold-increase ... All luciferase activities shown in transient transfection assays are corrected by the internal control activity of Renilla luciferase by pRL-TK To examine the effect of cAMP /PKA on TNFa-induced...
  • 7
  • 296
  • 0
Báo cáo Y học: Electrostatic properties of the structure of the docking and dimerization domain of protein kinase A IIa doc

Báo cáo Y học: Electrostatic properties of the structure of the docking and dimerization domain of protein kinase A IIa doc

Ngày tải lên : 08/03/2014, 22:20
... program MOLMOL [27] was used for secondary structure evaluation, solvent accessibility calculation, angular order parameters calculation, inter-helical angle calculation, and for protein structure ... restraints, provides a more realistic range of pKa values within the calculated rmsd, centered around a mean pKa We have performed mean pKa calculations to assess the involvement of speci c electrostatic ... understand the structural properties of the charged face, we have performed pKa calculations on the ensemble of 24 structures of RIIa D/D Figure presents a plot of the calculated apparent mean pKa...
  • 12
  • 536
  • 0
Báo cáo khoa học: Kinetic mechanism for p38 MAP kinase a A partial rapid-equilibrium random-order ternary-complex mechanism for the phosphorylation of a protein substrate potx

Báo cáo khoa học: Kinetic mechanism for p38 MAP kinase a A partial rapid-equilibrium random-order ternary-complex mechanism for the phosphorylation of a protein substrate potx

Ngày tải lên : 16/03/2014, 22:20
... upstream activators MAP kinase kinase (MKK3) and MAP kinase kinase (MKK6) Once activated, p38 MAPKa exerts its effect by directly phosphorylating transcription factors such as activating transcription ... concentrations were approximately doubled (194 lm p38 MAPKa, 549 lm ADP, 542 lm AMP-PCP) ATPase activity assay The ATPase activity of activated p38 MAPKa was characterized using the coupled assay ... respect to the binding and phos4633 Kinetic mechanism for p38 MAP kinase a A E Szafranska and K N Dalby Fig Preparation of activated p38 MAPKa and ATF2D115 (A) 10% SDS ⁄ PAGE analysis showing activated,...
  • 15
  • 554
  • 0
Báo cáo Y học: The Emery–Dreifuss muscular dystrophy associated-protein emerin is phosphorylated on serine 49 by protein kinase A pptx

Báo cáo Y học: The Emery–Dreifuss muscular dystrophy associated-protein emerin is phosphorylated on serine 49 by protein kinase A pptx

Ngày tải lên : 17/03/2014, 17:20
... muscles and contractures at the elbows and ankles A cardiac conduction defect develops in patients by their mid-30s associated with a substantial risk of sudden death Molecular defects are characterized ... Fellowship awarded to RCR and Muscular Dystrophy Campaign project grants awarded to AJS-S (RA3 ⁄ 593) and JAE (RA3 ⁄ 577 and RA3 ⁄ 655) and a grant from the Danish Natural Sciences Research Council ... is a Lundbeck Foundation Research Professor 12 13 References Nagano A, Koga R, Ogawa M, Kurano Y, Kawada J, Okada R, Hayashi YK, Tsukahara T & Arahata K (1996) Emerin deficiency at the nuclear...
  • 14
  • 418
  • 0