... incident to the CSIRC for tracking actions, such as determining if anyone has attempted to use the computers to access the IRS network and follow -on actions such as canceling remote access accounts ... Affairs CL:LA Director, Office of Program Evaluation and Risk Analysis RAS:O Office of Internal Control OS:CFO:CPIC:IC Audit Liaisons: Chief Information Officer OS:CIO Chief, Mission Assurance and ... sensitive data, we concur with the alternative corrective action to this recommendation Recommendation 8: Consider implementing a systemic disk encryption solution on laptop computers When the...
Ngày tải lên: 18/02/2014, 04:20
... cause of road and other accidents, domestic and public violence, and crime Long-term heavy drinking is a major risk factor for chronic disease, including liver disease and brain damage, and contributes ... and physical health) and ensure referral and links to a range of external services and support (such as stable accommodation, education, vocational and employment support and social connections) ... medical workforce, including general practitioners and other primary healthcare workers and hospital workers, has regular exposure to alcohol, tobacco and other drug use and its consequences and...
Ngày tải lên: 29/03/2014, 20:20
Báo cáo lâm nghiệp: "The survey of some factors affecting bark lesion development caused by Phytophthora cactorum on common beech and other broadleaved trees" pdf
... the Czech Republic (P gonapodyides, P cambivora, P citricola s.l., P. cinnamomi, P citrophthora), to confirm the pathogenicity of P. cactorum to common forest tree species (common beech, pedunculate ... (2003, 2008) etc We concluded that P cactorum and P citricola s.l could be very dangerous to common beech and other woody plants in our nurseries, parks and forests because they have commonly been ... lesion of red oak, CCF Acc No 3681, GenBank Acc No EF194774), P. cambivora P020.06 (stem lesion of sweet chestnut, CCF 3682, GenBank EF194777), P. citricola s.l P159.07 (root rot of pedunculate...
Ngày tải lên: 07/08/2014, 10:21
Báo cáo y học: " Effects of different fibrinogen concentrations on blood loss and coagulation parameters in a pig model of coagulopathy with blunt liver injury" docx
... additional effect on clinical relevant endpoints in this specific ani- Grottke et al Critical Care 2010, 14:R62 http://ccforum.com/content/14/2/R62 mal model, if no other coagulation factors ... VG, Cohen BM, Cohen E: Effects of coagulation factor deficiency on plasma coagulation kinetics determined via thrombelastography: critical roles of fibrinogen and factors II, VII, X and XII Acta ... paraffin and stained by H&E and a standard Elastica-van Gieson protocol for histological examination under light microscopy (Eclipse 50i, Nikon, Duesseldorf, Germany) Secondary, suspect sections of...
Ngày tải lên: 13/08/2014, 20:21
Primer on Electricity Futures and Other Derivatives
... Suzie Kito (MRW & Associates), Mike Lee (Montana Public Service Commission), and Ryan Wiser (LBNL) xi xii Acronyms and Abbreviations CFTC COB CPUC ESP FAC FERC MG NYMEX ORA OTC PBR PG&E PJM PPAC ... prices Marketers who buy on the spot market face the risk that the spot market price could substantially exceed fixed prices specified in contracts Electricity futures and other electric rate derivatives ... help electricity generators, consumers, and marketers manage, or hedge, price risks in a competitive electricity market Futures contracts are legally binding and negotiable contracts that call for...
Ngày tải lên: 30/10/2014, 22:31
28497 conversation lesson on mysteries conspiracies and other strange things
... popular conspiracy theories mentioned? Which have you heard of before? Do you know about any other conspiracies or mysteries? Talk about it Special Topic: Mysteries, Conspiracies, and Other Strange ... because not enough is known about it Vehement B F centered on/ around, focused on, to be concerned with Somewhat C G silly in an exciting or amusing way, crazy Fascinating D H the ability to change ... something shocking or catastrophic happens in our lives, simple explanations just aren't enough We crave deeper and _, and sometimes we create our own Conspiracy theories can attract a wide...
Ngày tải lên: 27/08/2016, 06:31
Summary of Phd. dissertation in forestry Research on scientific bases and propose some conservation measures for Pseudotsuga brevifolia W. C Cheng & L. K. Fu, 1975 in Ha Giang province
... necessary to have a research on the distribution and population status of this specie to develop a conservation plan Chapter NATURAL CONDITION AND SOCIOECONOMIC OF STUDY AREA 2.1 Natural condition ... study on the morphological, ecological and phenological characteristics of this species to be the constructing the measures for conservation and development of this rare species In this context, ... Result in survival cuttings of Pseudotsuga brevifolia Observation Schedule (day) Experimental No of Formulas cutting CT1A CT1B CT 1C CT1D CT2A CT2B CT 2C CT2D CT3A CT3B CT 3C CT3D CT4 Total/AVG 90...
Ngày tải lên: 01/11/2016, 22:32
RESEARCH ON THE CHANGE OF 2-AP AND OTHER VOLATILE COMPOUNDS IN PROCESSING BUN FROM RICE
... Research on the Change of 2-AP and Other Volatile Compounds in Processing Bun from Rice coupling with GC and GCMS SPME/GC enables for estimation of 2-AP low concentration like aromatic rice The ... identification and quantification of change in 2-AP and other volatile compounds, milled rice of KDM was soaked in water for 12 and 48 hours; non-soaked rice served as control 2.2 Extraction methods ... the accompanied fermentation process due to long duration soaking CONCLUSION By SDE extraction method and use response factor of collidine, 2-AP from pandan leaf was extracted, identified and...
Ngày tải lên: 28/08/2013, 16:28
Optimization of design and operating parameters on the year round performance of a multi-stage evacuated solar desalination system using transient mathematical analysis
... through the collector (kg/s), Cp is specific heat capacity (J/kg K) , Tfi is collector inlet temperature (K) For series combination of flat plate collectors For a system of collectors connected in ... radiation and natural convection are limited Thus, heat transfer between the hot saline water bed and the condensation surface in every stage is mainly conveyed by evaporation and condensation process ... evaporator and condenser surfaces One such unit is called as a stage The multi-stage desalination system consists of Ns number of such stages stacked one over the other The condenser surface of bottom...
Ngày tải lên: 05/09/2013, 16:11
Đ C ÔN TÂP SU 9 K 1
... C u 16 C u 17 C u 18 C u19: ch c : C u 20 C u 21 C u 22 C u 23 C u 24 C u 25 Nư c có kinh tế phát triển thần k sau chiến tranh giới thứ hai : A Mỹ B Nhật C Anh D Pháp Tổ ch c Liên Hợp qu c ... Man-đê-la B Phi đen Cax-tơ-rô C Hô-xe Mac-ti D Xu-cac-nô C u 45 Qu c gia Châu Á đầu '' C ch mạng xanh' ? A C u 46 C u 47 C u 48 C u 49 C u 50 Trung Qu c B Ấn Độ C Hàn Qu c D Nhật Bản M c tiêu A SEAN ... thách th c dân t c? 9,Hãy nêu thành tựu quan trọng c ch mạng khoa h c – k thuật thời gian gần Cu c cách mạng khoa h c – k thuật c t c dụng sống người? 10,Nhiệm vụ Liên hợp qu c ? Em nêu việc...
Ngày tải lên: 29/10/2013, 22:11
Tài liệu WHO policy on collaborative TB/HIV activities -Guidelines for national programmes and other stakeholders doc
... 1.HIV infections 2.Acquired immunodeficiency syndrome - prevention and control 3.AIDS-related opportunistic infections - prevention and control 4.Tuberculosis, Pulmonary - prevention and control ... HIV chronic care package CPT is a simple, well-tolerated and cost-effective intervention for people living with HIV and can be administered concomitantly to ART Evidence from randomized controlled ... AIDS Control Organization, India), Ashurova Rukshona (National Center for Prevention and Control of AIDS, Tajikistan), Holger Schünemann (McMaster University Health Sciences Centre, Canada), Lakhbir...
Ngày tải lên: 18/02/2014, 15:20
Tài liệu An Account of the Foxglove and some of its Medical Uses With Practical Remarks on Dropsy and Other Diseases doc
... reputation But Truth and Science would condemn the procedure I have therefore mentioned every case in which I have prescribed the Foxglove, proper or improper, successful or otherwise Such a conduct ... reputation as a surgeon and apothecary at Stourbridge, in Worcestershire "Consumptions are cured infallibly by weak decoction of Foxglove leaves in water, or wine and water, and drank for constant ... be expected that I could be very particular, much less could I take notes of all the cases which occurred Two or three of them only, in which the medicine succeeded, I find mentioned amongst my...
Ngày tải lên: 19/02/2014, 11:20
Tài liệu Báo cáo Y học: Mutations in the docking site for cytochrome c on the Paracoccus heme aa3 oxidase Electron entry and kinetic phases of the reaction pptx
... the acidic region responsible for cytochrome c docking While no direct structural information is at hand for the docked complex, the interaction domain for cytochrome c on the cytochrome bc1 complex ... Hoganson, C. W., Babcock, G.T & Ferguson-Miller, S (1999) Definition of the interaction domain for cytochrome c on cytochrome c oxidase I Biochemical, spectral, and kinetic characterization of surface ... oxidase, cytochrome bc1 and cytochrome c1 J Biol Chem 255, 4732–4739 Taha, T.S.M & Ferguson-Miller, S (1992) Interaction of cytochrome c with cytochrome c oxidase studied by monoclonal antibodies and...
Ngày tải lên: 22/02/2014, 07:20
The Breast Cancer Epidemic: Modeling and Forecasts Based on Abortion and Other Risk Factors potx
... protection Breastfeeding gives additional protection Hormonal contraceptives are conducive to breast cancer Hormone replacement therapy (HRT) is also conducive to breast cancer Modeling for England ... UK Contact: papriresearch@btconnect.com Acknowledgements: Particular thanks are due to the charities LIFE and The Medical Education Trust, which funded the research, to the national statistical ... 1995:779-810 Cancer Incidence Data, Office for National Statistics and Welsh Cancer Incidence and Surveillance Unit (WCISU) Available at: www.statistics.gov.uk and www.wcisu.wales.nhs.uk Accessed Jul...
Ngày tải lên: 06/03/2014, 02:21
Báo cáo khoa học: A study on genomic distribution and sequence features of human long inverted repeats reveals species-specific intronic inverted repeats pptx
... the intron knockout process and help to create complicated splicing patterns [39] On the other hand, CA-tracts and CA-rich sequences are confirmed to be regulators for alternative splicing One study ... heterochromatic silencing and histone H3 lysine-9 methylation by RNAi Science 297, 1833–1837 Glucksmann MA, Markiewicz P, Malone C & Rothman-Denes LB (1992) Speci c sequences and a hairpin structure ... Anatomical structure development Post-translational protein modification Ion transmembrane transporter Protein modification process Kinase activity Establishment of localization Cytoskeleton Ion channel...
Ngày tải lên: 07/03/2014, 00:20
Báo cáo khoa học: GHP, a new c-type green heme protein from Halochromatium salexigens and other proteobacteria potx
... Escherchia coli, on translation in vitro FASEB J 18, C1 7 C1 8 GHP, a new cytochrome c from H salexigens 29 Beckett D (2004) Functional switches in transcription regulation: molecular mimicry and ... the deformylase into the inactive Fe3+ ion, accompanied by the conversion of Cys90, a ligand of the catalytic iron center, into a cysteine sulfonic acid On the other hand, the light-sensitive nitrile ... soluble fraction of H salexigens, including cytochromes c4 , c , reaction center tetra-heme cytochrome c, flavocytochrome c sulfide dehydrogenase, bacterial ferredoxin, and high-potential iron-sulfur...
Ngày tải lên: 08/03/2014, 08:20
BÁO CÁO "RESEARCH ON THE CHANGE OF 2-AP AND OTHER VOLATILE COMPOUNDS IN PROCESSING BUN FROM RICE" doc
... Research on the Change of 2-AP and Other Volatile Compounds in Processing Bun from Rice coupling with GC and GCMS SPME/GC enables for estimation of 2-AP low concentration like aromatic rice The ... identification and quantification of change in 2-AP and other volatile compounds, milled rice of KDM was soaked in water for 12 and 48 hours; non-soaked rice served as control 2.2 Extraction methods ... the accompanied fermentation process due to long duration soaking CONCLUSION By SDE extraction method and use response factor of collidine, 2-AP from pandan leaf was extracted, identified and...
Ngày tải lên: 19/03/2014, 16:20
effect of processing parameters on pore structure and thickness of anodic
... increase in concentration of sulfuric acid increased the membrane thickness It was found that processing parameters can have a dramatic effect on pore characteristics The results in Tables and ... each sulfuric acid electrolyte concentration Acid concentration (wt%) Anodic aluminum oxide growth rate (m/h) 10 20 0.318 1.272 2.148 of fracture during the fabrication process Tube wall thicknesses ... Interpore distance of AAO tubular membranes produced by 3, 5, 7, 10 and 20 wt% sulfuric acid at 12.5, 15 and 20 V at ◦ C Concentration of oxalic acid (wt%) Concentration of sulfuric acid (wt%) Pore...
Ngày tải lên: 19/03/2014, 16:48
Báo cáo khoa học: Substrate specificity of the human UDP-glucuronosyltransferase UGT2B4 and UGT2B7 Identification of a critical aromatic amino acid residue at position 33 doc
... CTGGTGTGGCCCACAGAACTCAGCCACTGGATGAATATAAAG CTTTATATTCATCCAGTGGCTGAGTTCTGTGGGCCACACCAG CTGGTGTGGCCCACAGAATACAGCCACTGGATGAATATAAAG CTTTATATTCATCCAGTGGCTGTATTCTGTGGGCCACACCAG CTGGTGTGGGCAGCAGAACTCAGCCATTGGATGAATATAAAG ... CTTTATATTCATCCAGTGGCTGTATTCTGTGGGCCACACCAG CTGGTGTGGGCAGCAGAACTCAGCCATTGGATGAATATAAAG CTTTATATTCATCCAATGGCTGAGTTCTGCTGCCCACACCAG CTGGTGTGGGCAGCAGAATACAGCCATTGGATGAATATAAAG CTTTATATTCATCCAATGGCTGTATTCTGCTGCCCACACCAG 2B4F33Y 2B7Y33 L 2B7Y33F ... reaction was carried out with 50 lg protein and was incubated with 0.02 mM UDP- glucuronic acid containing 0.1 lCi UDP- [1 4C] glucuronic acid and 0.5 mM substrate as indicated in Experimental procedures...
Ngày tải lên: 23/03/2014, 09:21