kĩ thuật thao tác trên dna

... the DNA/ DNA and RNA /DNA oligonucleotide duplexes. In the present study, we determined the temperature- independent and temperature-dependent thermodynamic parameters of 24 DNA/ DNA and 41 RNA /DNA ... universally assigning the appropriate thermodynamic parameter sets. In the present study, the 24 DNA/ DNA and 41 RNA /DNA oligonucleotide duplexes, designed to avoid the formation of hairpin or slipped duplex ... Temperature dependence of thermodynamic properties for DNA/ DNA and RNA /DNA duplex formation Peng Wu 1, *, Shu-ichi Nakano 1 and Naoki Sugimoto 1,2 1 High Technology

Ngày tải lên: 22/02/2014, 07:20

... results exclusively from DNA- PKcs interactions with the DNA We also show that sequence differences in DNA termini can drastically influence DNA repair through altered DNA- PK activation Our results ... (DSBs) 1.3 DNA Damaging Agents in Cancer Therapy 1.4 Ku70/80 1.5 DNA- PKcs 14 1.6 Ku /DNA- PKcs Interactions 16 1.7 DNA/ DNA-PK Interactions ... NHEJ non-homologous end joining HR homologous recombination DDR DNA damage response DNA- PK DNA dependent protein kinase DNA- PKcs DNA dependent protein kinase catalytic subunit PIKKs phosphatidylinositol-3

Ngày tải lên: 24/08/2014, 09:33

... for the DNA containing subtle DNA lesions that not arrest the polymerases? DNA repair enzymes are molecular sensors of damaged DNA in the cell, since they recognize and repair damaged DNA It would ... suppression with transcription-coupled DNA repair integrity of the DNA as they are arrested at the bulky DNA lesions inflicted by mutagens (33) while processing along the DNA to carry out their functions ... Summary Alkylation of DNA at the O -position of guanine can lead to mutation and cell death These DNA adducts are repaired by the repair protein MGMT (O -methylguanine-DNAmethyltransferase) MGMT

Ngày tải lên: 16/09/2015, 12:15

... bound 32P-labeled DNA (R) is the ratio of the fraction of bound 32 P-labeled DNA in the presence of the competitor DNA (cpmbound ⁄ cpmtotal) to the fraction of bound 32P-labeled DNA in the absence ... turnover rate constant; Kd, dissociation constant; M.SssI, SssI DNA methyltransferase; M.HhaI, HhaI DNA methyltransferase; MTase, DNA methyltransferase; V0, initial rate of methylation; Vmax, maximal ... lesions that escape repair can influence DNA replication, transcription, and the interaction of different proteins with DNA All four B[a]P-N2-dG adducts inhibit DNA replication [13,14] The successful,

Ngày tải lên: 19/02/2014, 00:20

... cisPt -DNA, cisplatin-modified DNA; CTDBS, C-terminal DNA- binding site; EMSA, electrophoretic mobility shift assay; fl, full length; IAC, intrastrand crosslink; oligo, oligonucleotide; p53DBS, p53 DNA- binding ... protein with cisplatin-modified DNA (cisPt -DNA) have recently been studied [31– 36] In the absence of the p53DBS, enhancement of p53 sequence-nonspecific DNA binding due to DNA cis-platination was observed ... processes such as DNA synthesis and transcription [26] The bifunctional cisplatin DNA adducts slow down or block DNA or RNA polymerization and can hamper the initiation of DNA transcription [49]

Ngày tải lên: 19/02/2014, 05:20

... aggregative with aberrant DNA NC SSC Aggregative proteins LD DNA affinity Mono Q Marker NF Separated fractions no DNA relaxed A Aggregation-coupled DNA end-joining (kDa) 225 150 100 75 DNA- PKcs 180 k 170 ... Likewise, DNA- PKcs promoted predominant aggregation of ssDNA when incubated at relatively low concentrations At higher ratios of protein to DNA, DNA- PKcs started to interact with nicked and linear DNA ... Sepharose 0.5 M / FT No DNA Human Nuclear Extract Substrate A Aggregation-coupled DNA end-joining Input DNA M Takahagi and K Tatsumi - 1.0 M NaCl Nuclear fraction Denatured DNA Cellulose NC Nuclear

Ngày tải lên: 19/02/2014, 06:20

... major double-stranded DNA binding determinant in the E. coli DnaE [12]. Crystal structures revealed that this motif binds dou- ble-stranded DNA similarly in both PolC [8] and DnaE [6]. The b-clamp ... and DnaE. The ability to bind sin- gle-stranded DNA has indeed been demonstrated for the E. coli DnaE OB domain [12,16]. The very N-ter- minal region of PolC and the C-terminal domain of DnaE ... subtilis replisome [4] showed that the division of labor between PolC and DnaE is of a different nature. DnaE, much like eukaryotic DNA polymerase a, initially extends an Abbreviations OB, oligonucleotide

Ngày tải lên: 05/03/2014, 23:20

... expansion of DNA repeat sequences is associated with many genetic diseases in humans. Simple bulge DNA structures have been implicated as intermediates in DNA slippage within the DNA repeat regions. ... selected DNA sequences. Solid line, 20 l M free DNA. Dashed line: (A,C,E,G,I) complex of DNA with DDI-1A (50 l M), (B,D,F,H,J) drug-alone has been subtracted. Dotted line: (A,C,E,G,I) complex of DNA with ... polynucleotide kinase, E. coli DNA polymer- ase I, the Klenow fragment of E. coli DNA polymerase I lacking 3¢ to 5¢ exonuclease activity, Taq DNA polymerase and pfu DNA polymerase were from Takara

Ngày tải lên: 07/03/2014, 06:20

... products, including MutS, MutL, MutH, DNA helicase II, single-stranded DNA binding protein, exonuclease I, VII or RecJ exonuclease, DNA polymerase III holoenzyme and DNA ligase [1,7] In E coli, repair ... duplex DNA) were heat denatured with SDS loading buffer, analysed by 10% SDS ⁄ PAGE, followed by silver staining to visualize both proteins and DNA [(C) Heteroduplex DNA (D) homoduplex DNA; lane ... MutS–MutL -DNA complexes are formed by adding duplex DNA to a mixture containing MutS and MutL In experiments involving nucleotide cofactors such as ATP or ATPcS, MutS -DNA (or MutS–MutL -DNA) complexes

Ngày tải lên: 07/03/2014, 12:20

... formation of the Early protein C-terminal DNA- binding domain? ?DNA complexes of various types is based not only on the rigidity of the base sequences in the DNA spacers, but also on the intrinsic ... between amino acid side chains and DNA bases, a simple code for protein? ?DNA recognition based on noncovalent Abbreviations BPV-1, bovine papillomavirus strain 1; DBD, DNA- binding domain; E2, Early ... the DNA- binding helices, thus modulating the discrimination of specific versus nonspecific DNA sequences For both the E2s, we suggest that the ‘indirect readout’ [30] plays a significant role in DNA

Ngày tải lên: 16/03/2014, 10:20

... Harrington RE (1999) p53- induced DNA bending and twisting: p53 tetramer binds on the outer side of a DNA loop and increases DNA twisting... in DNA by monofunctional platinum(II) ... sequence-specific DNA binding activity. Active p53 binds as a tetramer to response elements naturally occurring in the human genome [consensus DNA response element (CDRE)]. Import- antly, DNA adducts ... in some tumor cells via the ability of its DNA adducts to reduce the binding affinity of the p53 protein to its consensus DNA sequence [13]. Similarly, DNA adducts of the new antitumor tri- nuclear

Ngày tải lên: 16/03/2014, 14:20

... U DNA ligase (Weiss units in the case of T4 DNA ligase) at 16 °C (T4 DNA ligase and E.coli DNA ligase) or 45 °C(Taq DNA ligase and H. Kuhn and M. D. Frank-Kamenetskii Ligation of ssDNA by T4 DNA ... ssDNA substrates [29,30], this property of T4 DNA ligase has, to our knowledge, not been reported. Unlike T4 DNA ligase, bacterial DNA ligases that we tested did not have any detect- able ssDNA ... analytes [9–11], in DNA nanotechnology [12,13], and in DNA computation [14–16]. T4 DNA ligase, the prototype of ATP-dependent DNA ligases [17–19], is the most commonly used DNA ligase. One factor

Ngày tải lên: 23/03/2014, 11:20

... Human DNA polymerases a, d and e in replication (1994) DNA replication in vitro by recombinant DNApolymerase-a-primase... step of human chromosomal DNA replication causes DNA ... bulk of DNA during nuclear DNA replication. These pols are structurally related, belonging to the family B DNA polymerases [2]. Nonetheless, all three perform additional roles in other DNA transactions ... conceive that a DNA synthesis function, other than DNA replication, prevails for G C Fig 7 Replicative DNA polymerases (pols) d and e partly colocalize with... for the study of DNA replication

Ngày tải lên: 30/03/2014, 10:20

... sponta- neous DNA oxidation and DNA oxidation induced by CSE, and can suppress menadione-induced cell death, making a small contribution to protection from oxida- tion of nuclear DNA induced by ... corresponding DNA fragment was PCR-amplified from a plasmid with full PRDX5 cDNA using primers BE-1 (GGCGGATCCATGG GACTAGCTGGCGTGTGCG) and BE-2 (GGCGA ATTCTTATCAGAGCTGTGAGATGATATTGGG) and DNA polymerase ... Chinese hamster cells decreases formation of 8-oxoG in mitochondrial DNA [20], but the role of this protein in protecting nuclear DNA from oxidation in human cells and the mecha- nisms of regulation

Ngày tải lên: 30/03/2014, 11:20

... level of DNA synthesis [8]. More recent studies confirmed that D4R is essential for vaccinia DNA synthesis, and that its essential function is unrelated to its ability to excise uracil from DNA [7]. ... delayed DNA syn- thesis. As observed previously, the mutant exhibited very little DNA synthesis in the first three days of infection (Fig 2A). In contrast, the rescued virus appeared to synthesize DNA ... with the DNA polymerase [9] imply that this molecule is part of the viral DNA replication complex. This interpretation of the data is consistent with the observed phenotype of delayed DNA synthesis

Ngày tải lên: 19/06/2014, 08:20

... level of DNA synthesis [8]. More recent studies confirmed that D4R is essential for vaccinia DNA synthesis, and that its essential function is unrelated to its ability to excise uracil from DNA [7]. ... delayed DNA syn- thesis. As observed previously, the mutant exhibited very little DNA synthesis in the first three days of infection (Fig 2A). In contrast, the rescued virus appeared to synthesize DNA ... with the DNA polymerase [9] imply that this molecule is part of the viral DNA replication complex. This interpretation of the data is consistent with the observed phenotype of delayed DNA synthesis

Ngày tải lên: 20/06/2014, 04:20

... real-time replication rate of a single DNA polymerase (DNAP) on a single-stranded DNA (ssDNA) stretched by a magnetic trap as shown in Fig. 5A. Similarly to RNAP, DNAP reads the base sequence information ... hybridized to the ssDNA for DNAP to initiate replication. As DNAP progresses, the molecule’s extension increases due to the difference in the elastic behavior between ssDNA and dsDNA. The stretching ... replicated DNA (squares) is intermediate between ssDNA (circles) and dsDNA (diamonds). The full line l p ðFÞ¼pl ds þð1 À pÞl ss is the superposition of elastic behavior of ssDNA and dsDNA at a

Ngày tải lên: 22/06/2014, 18:20

... kế tiếp nhau của ba protein: RPA, Dna2 và FEN-1. DNA polymerase δ trước tiên sẽ thế chỗ đoạn RNA primer và đoạn DNA do DNA polymerase α tổng hợp. Chuỗi DNA đơn sau đó sẽ được bao bọc bởi ... bằng DNA polymerase α để tạo ra một primer hỗn hợp RNA -DNA (khoảng 30 cặp base) và được tổng hợp thành đoạn Okazaki đầy đủ (khoảng 100- 150 cặp base) bằng DNA polymerase δ. Vai trò của DNA ... tương tự tương ứng của phức γ vi khuẩn và DnaN) tương tác với helciase (MCM) và Pol thuộc họ B hoặc D Ở E.coli phức kép γ tương tác với heclicase DnaB và 2 Pol III thông qua chuỗi polypeptide

Ngày tải lên: 02/07/2014, 11:21

... design DNAdirected alkylating agents by linking the alkylating pharmacophore to the DNA- affinity molecules (e.g., DNA intercalating agents, DNA minor groove binder) [7,8] In most cases, the DNA- directed ... http://www.ro-journal.com/content/6/1/7 DNA alkylating agents are used widely for treatment of a variety of pediatric and adult cancers because the cytotoxic effects of these agents can directly modify DNA and cause DNA lesions ... Enhancement of radiosensitivity in human glioblastoma cells by the DNA N-mustard alkylating agent BO-1051 through augmented and sustained DNA damage response Pei-Ming Chu1, Shih-Hwa Chiou2,3,4†, Tsann-Long

Ngày tải lên: 09/08/2014, 09:20

... phân tử DNA mới (bán bảo toàn). • (3) Mồi RNA (4-12 nucleotide) giúp DNA pol kéo dài chuỗi polynucleotide. • (4) Các enzyme và protein, bao gồm: ∀ • DNA pol kéo dài DNA đang tăng trưởng ∀ • DNA ... TÁI BẢN DNA VÀ SỬA CHỮA DNA 1. Các đặc tính và yếu tố thiết yếu của sự tái bản 2. Cơ chế của sự tái bản 3. Sự tái bản ở tế bào chân hạch 4. Sửa chữa DNA • Nguyên phân (tạo ... nucleotide theo hướng 5’→ 3’, theo cách đối song (với sợi cha-mẹ) và bắt cặp bổ sung ∀ • Không liên tục trên một trong hai sợi Cụ cheỏ baựn baỷo toaứn Phát triển theo hai hướng từ OriC Gắn nucleotide

Ngày tải lên: 10/08/2014, 23:22