justification of using order as a complexity measure

A study on the bennefits of using portfolios as a means of assessment in the writing development for the third year stdents of english at hanoi pedagogical university no 2

A study on the bennefits of using portfolios as a means of assessment in the writing development for the third year stdents of english at hanoi pedagogical university no 2

... Since the application of Communicative Language Teaching approach to EFL teaching, process writing and collaborative learning have been greatly emphasized as typical features of teaching writing ... CAE level is required in demanding academic and - 21 - professional settings Achieving a certificate at this level proves that a candidate has reached a very advanced level of English (CAE Handbook ... content analysis As it was remarked, “data obtained from qualitative research is usually detailed, rich, deep and qualitative study typically involves a small number of research subjects” (Barnes,...

Ngày tải lên: 16/07/2015, 07:45

65 894 7
Students perceptions of using portfolios as a means of evaluation in an english foreign language translation course

Students perceptions of using portfolios as a means of evaluation in an english foreign language translation course

... Using Portfolios as a Means of Evaluation in an English Foreign Language Translation Course, a Case Study at the Faculty of Foreign Languages, Hanoi Pedagogical University N02” (Graduation paper ... portfolio as well as ways to improve students’ self-learning portfolio The participants of the survey questionnaires are 44 third-year English-major students of the Faculty of Foreign Languages, Hanoi ... in more foreign language classes Based on the results of the survey, it is clear that portfolio has a great of benefits; however both teachers and students also face some challenges when implementing...

Ngày tải lên: 30/11/2015, 09:14

7 361 1
Báo cáo hóa học: " Reduced cytotoxicity of insulin-immobilized CdS quantum dots using PEG as a spacer" pot

Báo cáo hóa học: " Reduced cytotoxicity of insulin-immobilized CdS quantum dots using PEG as a spacer" pot

... shows the pattern of fibroblast proliferation as measured by BrdU assay after and 24 h of culture in media containing CSNPs, PCSNPs, and ICSNPs A significant difference in the acceleration of cell ... folate-decorated, quantum dots (QDs)-loaded nanoparticles of biodegradable polymers Biomaterials 2009, 30:1176 Alivisatos AP, Gu WW, Larabell C: Quantum dots as cellular probes Annual Review of ... analysis (ESCA, ESCA LAB VIG microtech, Mt 500/1, etc., East Grinstead, UK) with MgK a at 1, 253.6 eV and 150 W of power at the anode A survey scan spectrum was taken, and the surface elemental...

Ngày tải lên: 20/06/2014, 22:20

9 403 0
báo cáo khoa học: " Using the theory of planned behaviour as a process evaluation tool in randomised trials of knowledge translation strategies: A case study from UK primary care" pot

báo cáo khoa học: " Using the theory of planned behaviour as a process evaluation tool in randomised trials of knowledge translation strategies: A case study from UK primary care" pot

... intention and behaviour, because the behaviour data were at a practice level, a summary measure of intention for each practice had to be calculated This was generated in two ways – by taking the mean ... doctor, a score for each construct in the TPB model was calculated as the mean of all items contributing to the construct Cronbach’s alpha was used to ascertain the reliability of each of the scales ... implication for statistical analysis was that some measure of practice-level psychological cognitions had to be derived An obvious summary measure is the mean cognition of the primary care doctors...

Ngày tải lên: 10/08/2014, 10:23

9 368 0
Stability and in vivo evaluation of pullulan acetate as a drug nanocarrier

Stability and in vivo evaluation of pullulan acetate as a drug nanocarrier

... with a UV detector at 232 nm The main pharmacokinetic parameters were calculated by DAS 1.0 (Anhui, China) program Bioavailability (BA) is a measurement of the rate and extent of a therapeutically ... (Mw = 200,000) was purchased from Hayashibara (Tokyo, Japan) Epirubicin·HCl (EPI·HCl) was purchased from Hisun Pharmaceutical Co (Zhejiang, China) Poly (vinyl alcohol) (PVA) with an average molecular weight ... and the acute toxicity of PANs was evaluated in mice Morever, EPI was loaded into PANs and its pharmacokinetics was also assessed in rats to compare to the free drug Methods Materials Pullulan...

Ngày tải lên: 23/04/2013, 21:38

7 391 0
Evaluation of Dredged Sediment as a Silt and Clay Source for Artificial Tidal Flats

Evaluation of Dredged Sediment as a Silt and Clay Source for Artificial Tidal Flats

... chloride (PAC) as well as waste steel slag (WSS) (E5) A natural tidal flat (C3) at the same tidal level was chosen as a reference for monitoring benthic communities as well as physicochemical characteristics ... in artificial tidal flats in Japan, a growth test of R philippinarum was also carried out in DS mixtures MATERIALS AND METHODS Artificial tidal flats in real seashore Five artificial tidal flats ... 2009 Fig Location of the artificial and natural tidal flats in Tategami, Ago bay, Mie, Japan Table Sediment of artificial tidal flats in real seashore Run E1 E2 E3 E4 E5 Granulation of DS 1.5wt%...

Ngày tải lên: 05/09/2013, 09:38

13 586 0
Assessment of pretreatments and enzymatic hydrolysis of wheat straw as a sugar source for bioprocess industry

Assessment of pretreatments and enzymatic hydrolysis of wheat straw as a sugar source for bioprocess industry

... And such a whole suite of accessory enzymes is required for efficient xylan hydrolysis such as α-arabinofuranosidases and α-Larabinases that release arabinan [31], α-glucuronidases that release ... acetic acid Organic solvent such as acetone can be used to precipitate and separate the fractionated biomass The pretreatment has an advantage of operating at low temperature (50 °C) which capital ... feasible as great amounts of this valuable commodity would be wasted Besides lignin, miscellaneous components of wheat straw such as wax, pectin, and phenolic acids are also of great value and...

Ngày tải lên: 05/09/2013, 15:28

20 437 0
Using Linux As A Router

Using Linux As A Router

... the kernel to act as a packet forwarder Slackware came with many excellent precompiled kernels, but IP forwarding was not an option Apparently, some random RFC specifies that IP forwarding is not ... wife, and play guitar with his bare feet He is reachable via email at jonathan@co.chatham.ga.us Figure 1: Linux Router Network Diagram Figure 1: Linux Router Network Diagram Figure 2: RIP Gated ... where routed caused everything to fall apart As soon as we replaced routed with gated, all was well We moved the clone to the remote site, connected the ISDN terminal adaptors, auto-dialed between...

Ngày tải lên: 18/10/2013, 17:15

7 460 0
Báo cáo " Effects of using wastewater as nutrient sources on soil chemical properties in peri‐urban agricultural systems " ppt

Báo cáo " Effects of using wastewater as nutrient sources on soil chemical properties in peri‐urban agricultural systems " ppt

... lead (Pb) and zinc (Zn)); (ii) investigating the  effects  of application  of wastewater,  especially  as regards  trace  metal  accumulation and solubility.  2. Materials and methods  2.1. Location of the research areas  Soil  ... V.  Lazarova,  T.  Asano,  Challenges  of Sustainable irrigation with recycled water, in V.  Lazarova,  A.   Bahri,  Water  reuse  for  irrigation,  Agriculture,  Landscapes  and  Turf  Grass,  ... urban  area  to  rural  agricultural  land  [8,  9].  At  the  Nam  Dinh  site,  irrigation  using wastewater  started  in  the  1980s  as a result  of increasing  urbanisation.  The  sewage ...

Ngày tải lên: 14/03/2014, 15:20

10 313 0
Searching for a Mate: The Rise of the Internet as a Social Intermediary potx

Searching for a Mate: The Rise of the Internet as a Social Intermediary potx

... women of a certain age a reasonable measure of the lack of availability of partners for single men of the same age group (and vice-versa)? Despite the existence of age discrepant couples, age homophily ... the ACS) The higher rate of interraciality in HCMST is mainly due to the fact that the HCMST survey was offered only in English, whereas the ACS was offered in a variety of languages Asians and ... Hypothesis Partnership Rate Although the association between Internet access at home and having a romantic partner is a strong and statistically significant association, several important caveats apply...

Ngày tải lên: 15/03/2014, 21:20

50 470 0
Báo cáo khoa học: Zinc-binding property of the major yolk protein in the sea urchin ) implications of its role as a zinc transporter for gametogenesis ppt

Báo cáo khoa học: Zinc-binding property of the major yolk protein in the sea urchin ) implications of its role as a zinc transporter for gametogenesis ppt

... phosphate as a substrate for localization of the labeled MYP Statistical analysis Data were expressed as the mean ± SEM Statistical analysis was performed using instat software (GraphPad Software) The ... were measured by the Bradford method [51] using a Bio-Rad protein assay (Bio-Rad, Hercules, CA, USA) with bovine c-globulin as a standard Thyroglobulin (669 kDa), catalase (232 kDa), BSA (67 kDa) ... testis at stage 1, and eggs In all of the samples analyzed, a large protein peak was observed at an elution position of 72 mL (peaks a, b, c, and d), where the estimated molecular mass was about...

Ngày tải lên: 16/03/2014, 05:20

14 442 0
Báo cáo Y học: The mitochondrial-lysosomal axis theory of aging Accumulation of damaged mitochondria as a result of imperfect autophagocytosis ppt

Báo cáo Y học: The mitochondrial-lysosomal axis theory of aging Accumulation of damaged mitochondria as a result of imperfect autophagocytosis ppt

... (2000) Autophagy as a regulated pathway of cellular degradation Science 290, 1717–1721 23 Marzella, L., Ahlberg, J & Glaumann, H (1981) Autophagy, heterophagy, microautophagy and crinophagy as the ... mitochondria have a replicative advantage over normal mitochondria [56,57] Analogous selection for dysfunctional mitochondria may also occur in the case of aging; Wanagat et al recently reported that atrophic ... initiating the age-related accumulation of garbage Given this, it is reasonable to expect a further decrease in autophagocytotic capacity at old age and this may be related to the progressive accumulation...

Ngày tải lên: 17/03/2014, 23:20

7 444 0
Báo cáo khoa học: Lack of stabilized microtubules as a result of the absence of major maps in CAD cells does not preclude neurite formation pot

Báo cáo khoa học: Lack of stabilized microtubules as a result of the absence of major maps in CAD cells does not preclude neurite formation pot

... GTTGGTCTCGTCGCTCATCACATCACGAGG GCTTGAAGGCGCTGGATCTGCGACAATAG GACTGGGCTTTCATCAGCGACAGGTGGC GTGAACCACCAAAATCGGAGAACGAAGC CAGGTTCTCAGTAGAGCCAATCTTCGACCTGAC AGAGTCGGATGCAGTTGCCCGGGCAACA GGCTCCTCCAGCACCCTCCGGGTCCCG ... GGCTCCTCCAGCACCCTCCGGGTCCCG CCCCAAACTTGTGACCATCATTC GGAGAAATCATCTTGAGCATAGCG CGAACTCTCAAGGGC ATGCATCAGAACCATGCACG AGCCCTACAATTCCATCCTCACC GCTGAAGGAGACGATGAGGGTGA 82898–82923 83581–83552 91489–91517 ... no MAP band was observed (not shown) Gene and mRNA analyses of MAP1b, MAP2, Tau, and STOP The finding that apparently normal neurites are formed even when CAD cells lack MAP1b, MAP2, Tau, and...

Ngày tải lên: 23/03/2014, 05:22

14 416 0
A Study on the Effects of Argentine Tango as a Form of Partnered Dance for those with Parkinson Disease and the Healthy Elderly pptx

A Study on the Effects of Argentine Tango as a Form of Partnered Dance for those with Parkinson Disease and the Healthy Elderly pptx

... found that the waltz was just as good as traditional aerobic exercise and that people were happier, which was demonstrated by increases in a measure of quality of life, and greater likeliness ... Madeleine Hackney and a grant from the American Parkinson Disease Association to Gammon Earhart References Argue, J (2000) Parkinson’s disease and the art of moving Oakland, CA: New Harbinger Beauchet, ... (Motion Analysis Corporation, Santa Rosa, CA) Measurement sessions were conducted using a standardized script with specific instructions for each task Measurement sessions were videotaped and a blinded...

Ngày tải lên: 28/03/2014, 20:20

19 649 0
Báo cáo Y học: Characterization of selenoprotein P as a selenium supply protein docx

Báo cáo Y học: Characterization of selenoprotein P as a selenium supply protein docx

... metabolism? Proc Natl Acad Sci USA 93, 15086–15091 Saito, Y., Hayashi, T., Tanaka, A. , Watanabe, Y., Suzuki, M., Saito, E & Takahashi, K (1999) Selenoprotein P in human plasma as an extracellular ... essential trace nutrient for growth of WI-38 diploid human fibroblasts Proc Natl Acad Sci U.S .A 73, 2023–2027 Takahashi, K., Akasaka, M., Yamamoto, Y., Kobayashi, C., Mizoguchi, J & Koyama, J (1990) ... hydroperoxide was added [15] The oxidation of NADPH was followed at 340 nm at 37 °C and activity was expressed as micromoles of NADPH oxidized per minute TR enzyme assay TR activity was examined by...

Ngày tải lên: 31/03/2014, 08:20

6 371 0
A Portrait of the Artist as a Young Man ppt

A Portrait of the Artist as a Young Man ppt

... face and the voice went away Sorry because he was afraid Afraid that it was some disease Canker was a disease of plants and cancer one of animals: or another different That was a long time ago ... prefect was there again and it was his voice that was saying that he was to get up, that Father Minister had said 22 A Portrait of the Artist as a Young Man he was to get up and dress and go to ... face was pale and strange and he wore the white cloak of a marshal O how cold and strange it was to think of that! All the dark was cold and strange There were pale strange faces there, great...

Ngày tải lên: 31/03/2014, 14:20

317 342 0
báo cáo hóa học: " Considerations for the future development of virtual technology as a rehabilitation tool" doc

báo cáo hóa học: " Considerations for the future development of virtual technology as a rehabilitation tool" doc

... is to have most of the main data-set replicated across all the sites and transmit only incremental changes Furthermore the main data-set is often cached locally at each of the collaborating sites ... reconstruct a missing packet The virtual representation of a remote collaborator (avatar) is often captured as the position and orientation of the 3D tracking devices that are attached to the ... data to a multicast address and the routers that receive the data send copies of the data to remote sites that are subscribed to the multicast address One drawback of multicast is that it is often...

Ngày tải lên: 19/06/2014, 10:20

10 449 0
w