judge koroma right to health is a pillar of peace

GUARANTEE OF THE ACCUSED PERSON’S RIGHT  TO DEFENSE COUNSEL  a COMPARATIVE OF  VIETNAMESE, GERMAN AND AMERICAN LAWS

GUARANTEE OF THE ACCUSED PERSON’S RIGHT TO DEFENSE COUNSEL a COMPARATIVE OF VIETNAMESE, GERMAN AND AMERICAN LAWS

... and weaknesses of applying laws in each nation Finally, on the basis of studying theoretical foundations and applicable laws as well as the practical application of the laws of Germany and the ... expansion of the rights of defense counsel and the accused is emphasized This is a firm basis to improve the fairness of the legislation in general and the guarantee of the accused’s right to ... accused towards accusations of the State The concept of a due process of law has formed a foundation for the formation and development of the principle of the right to a fair trial This is a fundamental...

Ngày tải lên: 15/08/2014, 15:50

33 430 0
The Right to Health pdf

The Right to Health pdf

... the highest attainable standard of physical and mental health, rather than an unconditional right to be healthy •  he right to health is NOT only a programmatic goal to be T attained in the ... of public health relevant to the right to health and have reaffirmed commitments to its realization Declaration of Alma-Ata, 1978 The Declaration affirms the crucial role of primary health care, ... accountability and monitoring mechanisms  I.  WHAT IS THE RIGHT TO HEALTH? A.   Key aspects of the right to health • The right to health is an inclusive right.  We frequently associate the right to health...

Ngày tải lên: 05/03/2014, 10:20

52 368 0
MONITORING WOMEN''''S RIGHT TO HEALTH UNDER THE INTERNATIONAL COVENANT ON ECONOMIC, SOCIAL AND CULTURAL RIGHTS potx

MONITORING WOMEN''''S RIGHT TO HEALTH UNDER THE INTERNATIONAL COVENANT ON ECONOMIC, SOCIAL AND CULTURAL RIGHTS potx

... the existence of a national health policy; and the percentages of the GNP as well as national and regional budgets that are spent on health care Where available, States Parties are asked to provide ... development of an information management system for these data that would facilitate analysis of trends over time and comparisons of the status of groups within a country; and (5) analysis of these data ... States Parties' obligations in relationship to it Because a "violations approach" does not necessarily require access to extensive statistical data (although this approach may take advantage of...

Ngày tải lên: 14/03/2014, 14:20

20 538 0
“Nobody Remembers Us” Failure to Protect Women’s and Girls’ Right to Health and Security in Post Earthquake Haiti pdf

“Nobody Remembers Us” Failure to Protect Women’s and Girls’ Right to Health and Security in Post Earthquake Haiti pdf

... the capacity of the Haitian state to act in terms of available resources, and the need to rely on international assistance and cooperation, is a legitimate factor in assessing what measures Haiti ... importance of prenatal care and where to seek it is important if maternal mortality is to be reduced via prenatal assistance.135 The earthquake fundamentally changed the landscape of facilities ... right to the highest attainable standard of health, ” para 11, finding access to health- related information to be included in the right to health CEDAW protects the right of women to receive appropriate...

Ngày tải lên: 28/03/2014, 12:20

84 517 0
101 Ways to Market Your Business 101 Ways to Market Your Business is a collection of marketing pptx

101 Ways to Market Your Business 101 Ways to Market Your Business is a collection of marketing pptx

... price, packaging, delivery, benefits, quality, performance, features, availability, extras, service, proof and guarantees Join an affiliate programs “Pay per Sale” Exchange articles and content ... instead of mass media advertising Personalise all your email messages so that they all get read Using the person’s name is essential Follow up regularly with all your clients and potential clients ... clients Learn sales ideas from reading and studying other business advertising and marketing material Educate yourself with new strategies Form a strategic business alliance that allows you to share...

Ngày tải lên: 28/06/2014, 12:20

8 315 0
Báo cáo y học: "Is a purpose of REM sleep atonia to help regenerate intervertebral disc volumetric loss" pdf

Báo cáo y học: "Is a purpose of REM sleep atonia to help regenerate intervertebral disc volumetric loss" pdf

... support to this new hypothesis That is, aquatic mammals are not under the same gravitational demands as are land mammals and not require the same buttressing spinal mechanisms for stability They may ... Datta S, Maclean R: Neurobiological mechanisms for the regulation of mammalian sleep-wake behavior: Reinterpretation of historical evidence and inclusion of contemporary cellular and molecular ... Journal of Circadian Rhythms 2009, 7:1 stand clearly the gravitational influences on all adjacently associated mammalian structural tissues related to these muscles across day and night...

Ngày tải lên: 10/08/2014, 09:20

5 226 0
Báo cáo khoa học: " Bench-to-bedside review: Sepsis is a disease of the microcirculation" pps

Báo cáo khoa học: " Bench-to-bedside review: Sepsis is a disease of the microcirculation" pps

... restoration of an evenly distributed microcirculatory flow and inadequate oxygen transport How can the latter goals in particular be accomplished? Discussions about the role of vasodilators, particularly ... microcirculatory perfusion is shut down and is the final common pathway in shock Especially in septic shock, alterations in metabolic pathways called ‘cytopathic hypoxia’ can lead to additional tissue ... Cytopathic hypoxia in sepsis Acta Anaesthesiol Scand Suppl 1997, 110:87-95 Harvey W: Exercitatio Anatomica de Motu Cordis et Sanguinis in Animalibus 1628 Malpighi M: Opera Omnia 1687 Lehr HA,...

Ngày tải lên: 12/08/2014, 20:20

7 240 0
Tumor cell response to drug induced apoptosis is a function of intra cellular redox status 3

Tumor cell response to drug induced apoptosis is a function of intra cellular redox status 3

... central mechanism that can be specifically targeted for the treatment of cancer Caspases are a family of proteins that play an important role as effectors of apoptosis The caspases are a group of ... induction of apoptosis A receptor pathway that recruits caspase leading to Bid cleavage that engages the mitochondria by release of cytochrome C and caspase 9, or caspase directly activating caspase ... One caspase can activate another caspase leading to the formation of a caspase cascade that amplifies the death signal In a typical cell undergoing apoptosis two distinct mechanisms have been...

Ngày tải lên: 16/09/2015, 17:11

193 366 0
Tumor cell response to drug induced apoptosis is a function of intra cellular redox status 2

Tumor cell response to drug induced apoptosis is a function of intra cellular redox status 2

... cleavage provide additional evidence in favor of a mechanism for signaling Bax to the mitochondria that is either parallel to or independent of death receptor and/or caspase activation A similar ... receptor (data not shown), and inhibition of caspase activation had no effect on the mitochondrial translocation of Bax In addition, the relative lack of caspase activation and absence of downstream ... resulted in an increase in intracellular H2O2 and translocation of Bax to the mitochondria This translocation of Bax was inhibited by catalase, thus establishing the critical role of intracellular H2O2...

Ngày tải lên: 16/09/2015, 17:11

12 237 0
Tumor cell response to drug induced apoptosis is a function of intra cellular redox status 1

Tumor cell response to drug induced apoptosis is a function of intra cellular redox status 1

... function of activation of the apoptotic death pathway as evidenced by the significant increase in caspase activity, cleavage of the caspase-3 substrate PARP, and appearance of the sub-G1 fraction ... photoproduct of MC540, triggered mitochondrial generation of H2O2 that was responsible for the release of cytochrome c and downstream activation of the caspase cascade (21) Similar to the data obtained ... fluorimetric assays, and (C) poly(ADP ribose) polymerase cleavage was assessed by Western blot analysis D, DNA fragmentation was determined by propidium iodide staining and the appearance of sub-G1 fraction...

Ngày tải lên: 16/09/2015, 17:11

8 279 0
WEPs Call to Action Investing in Women's Right to Health Company Annex

WEPs Call to Action Investing in Women's Right to Health Company Annex

... MultiStakeholder Partnership Mobile Alliance for Maternal Action (MAMA) Lack of Access to Relevant Health Information MAMA delivers vital health information via mobile phones to new and expectant ... UNFPA and Farmatodo, Venezuela’s leading network of local pharmacies, teamed up to create Por Ti, an initiative to make more people aware of and encourage them to use sexual and reproductive health ... RSL has a retail supermarket chain in Bangladesh called Agora, which sells Aponjon’s Sponsor -a- Ma package The Sponsor -a- Ma package consists of a gift that is purchased in store, coupled with a donation...

Ngày tải lên: 03/12/2017, 22:38

4 71 0
Tài liệu Chiếu sáng trong truyền hình - Television Lighting Television is a means of changing pptx

Tài liệu Chiếu sáng trong truyền hình - Television Lighting Television is a means of changing pptx

... within a scene have the same color temperature A combination of filters and electronic adjustments is used to adapt color cameras to each new lighting situation Most cameras can adjust automatically ... on the camera Absolute rock bottom You'll see cameras advertised as LUX or LUX cameras LUX is equal to 19 foot candles LUX is about 37 foot candles I was suspicious, so a number of years ago I ... using a reflectance light meter The meter is held near a variety of very light and very dark parts of the subject and pointed toward each part of the subject to be measured The ideal contrast range...

Ngày tải lên: 26/01/2014, 04:20

6 463 1
Learning english is a piece of cake 1

Learning english is a piece of cake 1

... English is difficult and it’s hard to memorize new words ðeɪ θɪŋk ˈɪŋ ɡlɪʃ ɪz ˈdɪfɪk əlt ænd ɪts hɑːrd tə ˈmem ə raɪz njuː wɜːdz and grammatical rules In fact, learning English can be a piece of ... ˈeɪʃ ən doʊnt ˈ wɝːɪ ə ˈbaʊt ˈɡræm ə Don’t be afraid of making mistakes Just try to speak doʊnt biː ə ˈfreɪd ʌv ˈmeɪk ɪŋ mɪ ˈsteɪk dʒʌst traɪ tuː spiːk Speak English as much as possible spiːk ˈɪŋ ...  In fact, she is a sales person! “Improve” = cải thiện, cải tiến I want to improve my English! Many people are worried about learning English ˈmen i ˈpiːpl ɑːr ˈwʌrid ə ˈbaʊt ˈlɝːn ɪŋ...

Ngày tải lên: 27/01/2014, 20:11

2 1,7K 15
Báo cáo khoa học: Cardiac ankyrin repeat protein is a marker of skeletal muscle pathological remodelling pot

Báo cáo khoa học: Cardiac ankyrin repeat protein is a marker of skeletal muscle pathological remodelling pot

... CGCTTTCGGAGGTGCTTTCGCAG M1941p65.R: TCAGAGTTCCCTACCGAAGCAG MH181PO.F: CTCCAAGCAGATGCAGCAGA M225PO.P: CCGTGGTGCTGATGGGCAAGAA M267PO.R: ACCATGATGCGCAAGGCCAT 1584p21.F: GTACAAGGAGCCAGGCCAAG 1629p21.P: TCACAGGACACTGAGCAATGGCTGATC ... CGCTGTTAGACCTTTTGGCTGCAGTTTC 439mC8.R: CGCACTGTAAGACCCCAACA 6mC9.F: TCTGCACCCTCACCGTCTTC 58mC9.P: TCTCGAAGATATGACTCCAGGACCACAATATTTTCT 135mC9.R: GGCTTCCATGGCATACTCCA 616mCARP.F: CTTGAATCCACAGCCATCCA ... TGTTGTCGTGTGCTGGGATT 396mMLCfast.F: TGGAGGAGCTGCTTACCACG 423mMLCfast.P: ACCGATTTTCCCAGGAGGAGATCAAGAA 500mMLCfast.R: TCTTGTAGTCCACGTTGCCG 381mMLC-2V.F: GAAGGCTGACTATGTCCGGG 403mMLC-2V.P: ATGCTGACCACACAAGCAGAGAGGTTCTC...

Ngày tải lên: 07/03/2014, 03:20

16 428 0
Báo cáo khoa học: Epl1, the major secreted protein of Hypocrea atroviridis on glucose, is a member of a strongly conserved protein family comprising plant defense response elicitors potx

Báo cáo khoa học: Epl1, the major secreted protein of Hypocrea atroviridis on glucose, is a member of a strongly conserved protein family comprising plant defense response elicitors potx

... have been reported to act as phytotoxins [e.g cerato-platanin of Ceratocystis fimbriata f sp platani, Snodprot1 of Phaeosphaeria nodorum and Sp1 of Leptosphaeria maculans) or human allergens and ... culture filtrates of Ceratocystis fimbriata f sp platani, in the cell walls of ascospores, hyphae and conidia of this fungus The authors suggested that cerato-platanin may have a similar role to hydrophobins ... a distance algorithmic method Stability of clades was evaluated by 1000 bootstrap rearrangements Bootstrap values lower than 20% are not displayed in the cladogram RNA isolation and hybridization...

Ngày tải lên: 07/03/2014, 12:20

14 494 0
Báo cáo Y học: Properties of group I allergens from grass pollen and their relation to cathepsin B, a member of the C1 family of cysteine proteinases pdf

Báo cáo Y học: Properties of group I allergens from grass pollen and their relation to cathepsin B, a member of the C1 family of cysteine proteinases pdf

... recombinant allergen after affinity purification using the mAb IG12 [18] The natural allergen Phl p was also found to be capable of degrading a synthetic substrate at a papaincleavage site after incubation ... The Giardia cyst wall consists of a carbohydrate/peptide complex [32] which is resistant to cleavage with chymotrypsin, trypsin, papain, or pronase Protozoan parasites of the genus Giardia are ... supernatant was applied in lane Expression supernatant in deglycosylation buffer is applied in lane Addition of N-glycosidase A leads to abolished proteolytic activity of the allergen in lane Lane...

Ngày tải lên: 08/03/2014, 22:20

10 535 0
Support to woman by a companion of her choice during childbirth: a randomized controlled trial potx

Support to woman by a companion of her choice during childbirth: a randomized controlled trial potx

... duration of first stage of labor; amniotomy in relation to the time of hospital admission and cervical dilation; color of amniotic fluid; use of oxytocin in relation to cervical dilation; time of analgesia ... effect are common This effect describes a lack of criticism due to social ability and/or fear of reprisals, or because of a sensation of relief at having gone through a safe experience and having a ... Oxytocin Analgesia Functional Dystocia Absent Tachysystole Hypo/oligo-systole Color of amniotic fluid Clear Meconium-stained Fetal heart rate Unaltered Altered Type of delivery Vaginal Caesarean...

Ngày tải lên: 14/03/2014, 16:20

7 338 0
Socioeconomic position and health in a population of Brazilian elderly: the Bambuí Health and Aging Study (BHAS) pdf

Socioeconomic position and health in a population of Brazilian elderly: the Bambuí Health and Aging Study (BHAS) pdf

... agudeza visual, grado de dificultad para caminar 300 metros, incapacidad para realizar las actividades cotidianas debido a problemas de salud en las semanas previas y seropositividad a Trypanosoma cruzi), ... de la salud, a n se debate hasta qué punto esa relación se mantiene durante la edad avanzada El objetivo de este trabajo fue examinar la asociación entre la situación socioeconómica y la salud ... diseases (asked as, “Has a doctor ever said that you had angina pectoris, myocardial infarction, arthritis, or any other disease?”); (6) other measures of health status (self-rated health in the...

Ngày tải lên: 14/03/2014, 20:20

8 735 0
Community Health Workers: a review of concepts, practice and policy concerns ppt

Community Health Workers: a review of concepts, practice and policy concerns ppt

... 15 Akramul Islam(Islam, Wakai, Ishikawa, Chowdhury, & Vaughan, 2002) Bangla desh 16 Joel D et al, (Joel, Sathyaseelan, Jayakaran, Vijayakumar, Muthurathnam & Jacob, 2003) RamosCrequeira (RamosCrequeira, ... costs variation in health services and to assess outputs of rural health facilities The aim of this study was to evaluate and analyse the nature, performance and costs of a sample of periurban and ... Zwarenstein, Aja, Wyk et al., 2005) (for example in India, AWARE in Andhra Pradesh, CINI in Kolkata, CRHP in Jamked, RUHSA in Tamil Nadu, and SEARCH in Maharashtra (Antia & Bhatia, 1993) Pakistan...

Ngày tải lên: 14/03/2014, 20:20

32 517 0
The role of pictures in improving health communication: A review of research on attention, comprehension, recall, and adherence doc

The role of pictures in improving health communication: A review of research on attention, comprehension, recall, and adherence doc

... contribution of pictures to health education is to attract the attention of patients and families and to stimulate them to attend to the information 3.2 Do pictures draw attention to health education materials? ... intended audience that health information is often unfamiliar to patients and contains complex concepts and words This is, in part, caused by the tendency of health professionals to use the same technical ... that studies in and outside of health education can be an important source of hypotheses for health educators rather than a source of conclusions that can be applied directly to health education...

Ngày tải lên: 14/03/2014, 21:20

18 919 0
w