japanese base phrase chunking

Ngày tải lên: 17/03/2014, 02:20

Ngày tải lên: 23/03/2014, 16:20

Ngày tải lên: 23/03/2014, 17:20

Ngày tải lên: 23/03/2014, 18:20

Ngày tải lên: 20/02/2014, 19:20

... file Base Solid 4.3.3. Chỉnh sửa các Base Solid: Ta có thể kéo dÃn hoặc thu nhỏ một Base Solid và lấy ra hoặc xoá các mặt. Sau khi bổ sung một phác thảo và một Sketched Feature tới một Base ... chỉnh sửa Base Solid: Các công cụ chỉnh sửa Base Solid có sẵn cho việc chỉnh sửa các mô hình Solid mà đợc tạo trong hệ thống CAD khác và ghi dới dạng file .sat hoặc .stp. Dể chỉnh sửa các Base ... tợng Base Solids trên cửa sổ duyệt để kích hoạt môi trờng Solid Model. Dùng môi trờng Solid Model để định vị các Work Feature, chỉnh sửa các Base Solids hoặc sử dụng các cạnh của một mặt Base...

Ngày tải lên: 27/08/2012, 13:54

... CSDL đã có: Cú pháp ALTER DATABASE database_name { <add_or_modify_files> | <add_or_modify_filegroups> | <set_database_options> | MODIFY NAME = new_database_name | COLLATE collation_name } [;] RDBMS ... có thể bị hủy bỏ ALTER DATABASE database_name { <add_or_modify_files> | <add_or_modify_filegroups> | <set_database_options> | MODIFY NAME = new_database_name | COLLATE collation_name }[;] Trong ... chụp đã được tạo. Cú pháp: CREATE DATABASE database_snapshot_name ON ( NAME = logical_file_name, FILENAME = ‘os_file_name’ ) [ , n ] AS SNAPSHOT OF source_database_name [;] RDBMS and Data Management/...

Ngày tải lên: 01/09/2012, 09:09

Ngày tải lên: 05/10/2012, 08:23

... acid plus 0.044 M sodium acetate (Ans: 1.3, 2.88, 8.79, 2.27, 4.2) Polyatomic Acids & Bases 13. Phosphorus acid, H 3 PO 4 , is actually a diprotic acid; K a1 = 1.0 X 10 -2 and K a2...

Ngày tải lên: 05/10/2012, 12:19

... Knowledge Base System Basic Knowledge CHAPTER 4 – SYSTEM DESIGN 4.1 DATABASE DESIGN 4.1.1 Database Normalization Before starting normalization, we ... 5, 6, 7 HUT – Genetic Computer School Page29 Knowledge Base System Basic Knowledge • Data Structure and Algorithm • Database 1 • Database 2 • MIS • Computer Aided- Accounting • Software Engineering • ... members can do a Quick Search (based on Article keywords and Article titles) or Advanced Search based on various criteria. HUT – Genetic Computer School Page42 Knowledge Base System Basic Knowledge...

Ngày tải lên: 08/10/2012, 15:10

... đánh giá RL acid -base chính xác cần cả ABG và điện giải  Cần tiếp cận một cách hệ thống  Cần nhớ 3 quy tắc  “bình thường” về khí máu có thể là không bình thường về Acid - Base  Điều quan ... toan chuyển hóa và cả kiềm chuyển hóa – thường là một cấp và một là mạn tính Rối loạn acid - base có mấy loại ? nhiễm toan nhiễm kiềm pH<7,35 pH>7,45 Hoâ haáp Chuyeån hoùa Chuyeån hoùa ... (1 HH + 2 CH) diễn ra đồng thời – Hướng của pH sẽ chỉ rõ rối loạn nguyên phát! Rối loạn Acid -Base hỗn hợp Tại sao?  Cho mỗi 1 mmol acid được chuẩn độ bằng hệ thống đệm carbonic acid,...

Ngày tải lên: 22/10/2012, 15:50

... Sai 4. Base dư là tổng số các anion đệm của một lít máu toàn phần A. Đúng B. Sai 5. Base đệm là tổng số các anion đệm của một lít máu toàn phần A. Đúng B. Sai 6. Base dư là sự chênh lệch trị số base ... 370C D. Là sự chênh lệch trị số base đệm đo bởi một người đang được xét nghiệm và trị số base đệm ở người bình thường. E. Các trên đều đúng. 38. Base dư (EB: Excess Base) là: 1. Tổng số các anion ... 21. Trong lâm sàng, các thông số để đánh giá thăng bằng acid base quan trọng nhất là A. pH máu B. Dự trữ kiềm, p CO 2 C. Base đệm D. Base dư E.Tất cả các câu trên đều đúng 1 3. p CO 2 giảm Chọn...

Ngày tải lên: 24/10/2012, 14:34

... 1982;13(11):24-30. 16. Jenkins R, Sredl D, Hsueh K., Ding C. Evidence-based nursing process (EBNP) consumer culture attribute identity: A mes- sage-based persuasion strategy study among nurse executives in ... pub- lished over 85 professional articles, 3 books, and is currently completing her 4 th , EVIDENCE-BASED LEADERSHIP STRATEGIES FOR NURSE ADMINISTRATORS, ADVANCED PRACTICE NURSES (APNs), AND DOCTORS ... 2010. Dr. Sredl’s research has focused on the Chief Nursing Executive (CNE) and the Evidence-Based Process (EBP). She is Associate Teaching Professor of Nursing at the University of Missouri...

Ngày tải lên: 26/10/2012, 08:57

... for management (in Japanese) . Quality, Journal of the Japanese Society for Quality Control, 29, 292-299. Hirotsu, C. (1992). QC technology (in Japanese) . Quality, Journal of the Japanese Society ... acquire basic TQC concept In-house TQC Orientation Course 1 day JUSE: Union of Japanese Scientist & Engineers, JSA: Japanese Standards Association TPOS is the friendly tailor-made software of ... CORRESPONDENCE COURSE (6 MONTHS) This course is based on two textbooks, one for methods and the other for practice of quality control. Similarly the Japanese Standards Association (JSA) provides...

Ngày tải lên: 26/10/2012, 09:41

... Replacement of cisplatin with nedaplatin in a definitive 5-fluorouracil/ cisplatin-based chemoradiotherapy in Japanese patients with esophageal squamous cell carcinoma Akiko Kuwahara 1 , Motohiro ... 5-fluorouracil (5-FU) were investigated in Japanese patients with esophageal squamous cell carcinoma, who were treated with a definitive 5-FU/CDDP-based chemoradiotherapy. Methods: Fifty-six ... positive supraclavicular lymph nodes were defined as M1a. Table 2. Clinical Outcome in 56 Japanese Patients with Esophageal Squamous Cell Carcinoma N % Clinical Response Complete response...

Ngày tải lên: 26/10/2012, 09:53

... 5’- AAGGAGGCACTGGGAGAGGGGAAAT -3’ (bases -1323 to -1299 from the major transcriptional initiation site) and antisense, 5’-AATTAGCTGGGCATGGTGGCAGGCG-3’ (bases -1075 to -1051)) that recognize ... oligonucleotides (sense, 5’-AAGGAGGCACTGGGAGAGGGGAAAT-3’ (bases -1323 to -1299) and antisense, 5’- CCCCACCAAGCCAACACAGGATGGA -3’ (bases -919 to-895) were used to amplify a 429-bp product from ... 12-lead ECG (Code 3-1 or 3-3), and female gender [20,21]. On the other hand, Freitag et al., based on multivariate models adjusting for known risk factors, showed that elevated plasma BNP...

Ngày tải lên: 26/10/2012, 10:04

... 2.3Cause of Japanese Foreign Direct Investment Decrease in Vietnam The cause of decreasing Japanese FDI in Vietnam is comprised of many factors from both Vietnamese and Japanese sides 2.3. 1Japanese ... studying Japanese language, understanding Japanese culture, civilization, economic development, so I would like to choose the subject: “ SOME SITUATION AND MEASURES TAKEN TO ATTRACT JAPANESE ... stage of opening and economic development of Vietnam, Japanese Government has granted financial and technical assistance to Vietnam. Japanese entrepreneurs were pioneer in investment and cooperation...

Ngày tải lên: 27/10/2012, 16:51

... Rice-fluid derived from unpolished Japanese rice against clinical Escherichia coli E1 isolate. Clinical E. coli E1 isolate was exposed to Rice-fluid derived from unpolished Japanese rice (●), from ten-fold ... derived from unpolished Japanese rice on the morphology of Helicobacter pylori ATCC43504 cells. H. pylori ATCC43504 strain was exposed to Rice-fluid derived from unpolished Japanese rice. Samples ... from unpolished and polished Japanese raw rice revealed remarkably strong bactericidal activities, and followed by the Rice-fluid derived from usually cooked Japanese rice. The number of...

Ngày tải lên: 31/10/2012, 17:03

... lý chất lượng Hệ thống quản lý chất lượng Q -base lập nhóm quản lý chất lượng Q -Base, đào tạo hệ thống chất lượng Q -base cho nhóm quản lý chất lượng Q -base, điều tra hiện trạng về cơ cấu tổ chức, ... LƯỢNG Q -BASE 4 2.1.Các chuẩn mực của hệ thống chất lượng quản lí chất lượngQ -Base 4 2.2.Lợi ích của việc áp dụng và được chứng nhận phù hợp Q -Base 4 Lợi ích sâu xa của việc có hệ thống Q -Base ... CHẤT LƯỢNG Q- BASE 3.1.NGHIÊN CỨU ÁP DỤNG HỆ THỐNG QUẢN LÝ CHẤT LƯỢNG Q -BASE TẠI CÔNG TY CỔ PHẦN HIỆP THÀNH LÂM ĐỒNG 3.1.1.Đặt Vấn Đề Hệ thống quản lý chất lượng Q -Base (Quality base) được tổ...

Ngày tải lên: 31/10/2012, 17:05

... reserved Research paper Serum cystatin C levels to predict serum concentration of digoxin in Japanese patients Tsutomu Nakamura 1 , Takeshi Ioroi 1 , Toshiyuki Sakaeda 1 , Masanori Horinouchi 1 , ... with Cr in terms of the estimation of the steady-state serum trough concentrations of digoxin in Japanese patients. Forty patients treated with digoxin and 56 healthy elderly subjects were participated ... normal range of Cys-C in the serum is from 0.55 (mean-1.96SD) to 0.99 (mean+1.96SD) mg/L in Japanese[ 3], with no inter-ethnic difference [4], and a higher level has been thought to be an...

Ngày tải lên: 31/10/2012, 17:08