is the moon is made of green cheese a scientific hypothesis
Báo cáo khoa học: "Is the Generally Accepted Strategy of Machine-Translation Research Optimal?" ppt
... translation and mathematical linguistics group at the Mathematical Institute of the Computation Center of the Bulgarian Academy of Sciences (Part IV). I When talking about the strategy of ... definition of their basic characteristics requires, in the first place, a generalization and analysis of these factors and, in the second place, a comparative analysis of the specific algorithms ... of Mathematical and Applied Linguistics and Machine Translation at the Academy of Sciences of the Georgian Soviet Socialist Republic (GAN); a group working on MT and mathe- matical linguistics...
- 8
- 379
- 0
Báo cáo khoa học: A novel serine protease highly expressed in the pancreas is expressed in various kinds of cancer cells potx
... from the humantrypsinogen prepro sequence was amplified from humanpancreatic cDNA using the primer set (forward, CCCAAGCTTACCATGAATCTACTCCTGAT; reverse, GTTGGTACCTTGTCATCATCATCAAAGG), and inserted ... 7(TACACACCCTGACCCGCATC) and 6 as template.Sequence analysis The sequence of the cDNA was analyzed using genetyxsoftware (Software Development Co. Ltd, Tokyo, Japan). A novel serine protease ... brain.Biochim Biophys Acta 1350, 11–14.11 Ogawa K, Yamada T, Tsujioka Y, Taguchi J, Takaha-shi M, Tsuboi Y, Fujino Y, Nakajima M, YamamotoT, Akatsu H, Mitsui S & Yamaguchi N (2000) Localiza-tion...
- 13
- 483
- 0
the obstacle is the way the timeless art of turning trials into triumph
... power—ours, and other people’s is frittered away in this manner.To see an obstacle as a challenge, to make the best of it anyway, that is also a choice a choicethat is up to us.Will I have a chance, ... bad one, or that the obstacle you face is intimidating or burdensome. What matters is thatright now is right now. The implications of our obstacle are theoretical—they exist in the past and the ... ol’emotional freak-out. Some of us almost crave sounding the alarm, because it’s easier than dealingwith whatever is staring us in the face.At 150 miles above Earth in a spaceship smaller than a VW,...
- 122
- 560
- 0
The experience is the Marketing
... That’s all well and good, butas yet another adjective-based idea it only affectsmarketing materials around the edges. We aretalking about a fundamentally new way of attracting and retaining your ... tourism is already rampant,including (but not limited to) the U.S. hubs of Las Vegas, Orlando, Times Square inManhattan, Chicago’s Magnificent Mile, andMinnesota’s Mall of America in the U.S., ... they spend. The American Girl Place achieves this level of retail success precisely because it hasso thoroughly abandoned the “store”paradigm. (Proof? The question visitorsalready inside the...
- 14
- 336
- 0
Tài liệu The Experience IS the Marketing pdf
... purebrochure-ware rather than experience-fare.Perhaps the best examples of flagship onlineexperiences are gamesites likewww.MaMaMedia.com. But many companiesare beginning to make at least part of theirflagship ... Indianapolis, DaytonaBeach, Stuttgart, perhaps, and maybe even the Bonneville Salt Flats. (And how about thatmountain up which every carmaker’s SUVclimbs in their commercials?) These hublocations ... to the brim with a cold one!). And last year General Mills openedup Cereal Adventure at the Mall of America inPeople have become relativelyimmune to messages targeted at them. The way to reach...
- 14
- 385
- 0
The Costs and Financial Benefits of Green Buildings: A Report to California’s Sustainable Building Task Force pptx
... Seattle, and Portland; San Mateo County; the University of California; the Department of the Navy; the federal General Services Administration; and the states of Oregon, New York and Maryland ... photovoltaic panels on the roof of the Franchise Tax Board Building in Rancho Cordova – which is the largest array on any state office building in the country; Assisting the Chancellor of the new ... energy, water, and waste; lower operations and maintenance costs; and enhanced occupant productivity and health. As Figure ES-1 shows, analysis of these areas indicates that total financial benefits...
- 134
- 772
- 0
the natural way of farming - the theory and practice of green philosophy
... people and the average Japanese farmer only ten, but Japanese farmers actually have a higher productivity than American farmers. It just appears the other way around because Americans farm under ... yard of land simply vanish, and the swarms of fireflies that fly up from the stands of grass disappear at once. The second application kills off the chalcid flies, which are important natural ... control of the disease has led to the present state of affairs where pesticides are applied several times a year as a sort of panacea. But as research digs deeper and deeper, what was once accepted...
- 227
- 562
- 0
The Role and Responsibilities of Accounting Officers: A Memorandum for Accounting Officers pdf
... Accounts and the Finance Accounts Apart from the Appropriation Accounts and the Finance Accounts, the C&AG audits a number of other accounts prepared by Departments and Offices. The others ... of the transactions in the State of the FEOGA Fund. 1.14 Other C&AG Audits The C&AG also audits the accounts of Health Boards, Vocational Education Committees, non-commercial state ... addressed as part of a risk assessment and management programme are wide-ranging and include strategic, operational, financial and reputational risk. A risk strategy does not mean that sensible risks...
- 43
- 480
- 0
The Evolving Spatial Form of Cities in a Globalising World Economy pot
... anagendaforscholarlyresearchonmetropolitanareasthatachievedundeniablesuccessas a workableparadigm.Taking a humanecologyapproachastheiranalyticpoint of departure, the ‘ChicagoSchool’urbanistsused the model of concentricringstodirectattentiontosuchproblemareasaslandusepatterns,urbanlifestyles,ethnicrivalriesand the effects of urbanenvironmentonhumanbehaviour.Despitechallengesfromalternativeperspectives, the ChicagoSchooldominated the field of urbanstudiesformost of the twentiethcentury(Dear&Flusty1997;Nijman2000).Beginning ... urban planning as a panacea for social ills, a nostalgicfascinationwith‘small is beautiful’, a turn todecorativepastiche(or the freeplay of stylesandhistoricistallusions)and a growingmoralpanicassociatedwith the ... 1999;Vasconcellos1997). The subwaysystemcanbarelyhandle a fraction of the demand,andanefficientfreewaysystemremains a distantdream. The urbanlayoutresemblesLosAngeles,because of itssheerhorizontalbreadth,andManhattan,because of itsdenseclusters of skyscrapers.But the crazy-quiltpattern of the cloggedandnarrowstreetscapemakesnavigating the urbanlandscape a sheernightmare(Godfrey1999;Romero200 0a; Romero2000b).SãoPaulowasnotalways a city of suchextremes.In1960,beforeanestimated46millionBraziliansleftruralareasforcitiesin a four-decademigrationthatwasone of the largest of the twentiethcentury,SãoPaulowas a relativelycalm,sedatecity of 3.7millionresidentswithincomedisparitiesnotnearlyasskewedastheyhavebecome.Anextensivenetwork of trolleysandbuses,alongwithonly164,000privateautomobiles,provided...
- 64
- 394
- 0
THE ECO-TOURISM VALUE OF NATIONAL PARK: A CASE STUDY FROM THE PHILIPPINES pdf
... Pulag as a National Park by conducting an ex-post economic valuation of the recreational value of Mt. Pulag. What is really the true value of this program? The overall goal of the study is ... tourism or leisure aspects of PAs. The aim of this paper is to estimate the value of the recreational benefits from Mt. Pulag National Park (MPNP) of Cordillera Administrative Region (CAR), ... “Economic valuation of a protected area: Lanao Danao National Park”. Based from the findings of the study, variables affecting preservation demands and total WTP are age, household annual income,...
- 32
- 943
- 0
Báo cáo khoa học: "THE LEXICAL EXPRESSIONS SEMANTICS OF COMPARATIVE IN A MULTI-LEVEL SEMANTIC PROCESSOR" ppt
... explanation of how they treat compar- atives nor any characterization of the breadth of their treatment. Two exceptions are the recent papers of Ballard (1988) and Rayner and Banks (1988). The ... compar- ison attribute ambiguity when there is more than one applicable MTrans rule for a particular EL mapping predicate. We define a candidate map- ping as any DML mapping that, on the basis ... mapping is a mapping from the do- main of the denotation of the subject of the CE to the domain of the base order (e.g. the map- ping from a rectangle to its length). The object mapping is...
- 8
- 402
- 0
Báo cáo hóa học: " The efficacy and value of emergency medicine: a supportive literature review" pdf
... Stroke, cardiovascular disea se, cancer,and trauma have, for the first time, surpassed commu-nicable diseases and are listed as the major global causes of death and disability. EM care delivery ... WashingtonUniversity School of Medicine and Health Sciences, Bethesda, MD, USAFull list of author information is available at the end of the articleHolliman et al. International Journal of ... coronarycatheterization team. Acad Emerg Med 2008, 15:784-787.206. Kharbanda AB, Fishman SJ, Bachur RG: Comparison of pediatricemergency physicians’ and surgeons’ evaluation and diagnosis of appendicitis. Acad Emerg...
- 10
- 515
- 0
Báo cáo hóa học: "Research Article On the Nonexistence and Existence of Solutions for a Fourth-Order Discrete Boundary Value Problem" doc
... to the positive eigenvalues of M.Proof. From the proof of Theorem 4.2, it is easy to know that J is bounded from above andsatisfies the P-S condition. It is clear that J is even and J00, and ... Applicable Analysis, vol. 59, no. 1–4, pp. 225–231, 1995.6 Z. Bai and H. Wang, “On positive solutions of some nonlinear fourth-order beam equations,” Journal of Mathematical Analysis and Applications, ... ordernonlinear difference equations,” Journal of Mathematical Analysis and Applications, vol. 322, no. 2, pp.930–956, 2006.13 E. Thandapani and I. M. Arockiasamy, “Fourth-order nonlinear oscillations...
- 18
- 371
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25