... result A proof is part of a situational ethic Situations change, mathematical values and standards develop and evolve, and thus the very way that we mathematics will alter and grow This is a book about ... reams and reams of data about the motions of the planets His gifted student Johannes Kepler was anxious to get his hands on Brahe’s data, because he had ideas about formulating mathematical laws ... that a mathematician is someone who spends all day hacking away at a computer Neither of these contentions is incorrect, but they not begin to penetrate all that a mathematician really is Paraphrasing...
Ngày tải lên: 21/02/2014, 09:20
... antizyme is a rapidly degraded protein and that as with ODC, the degradation of antizyme is also carried out by the proteasome Antizyme mRNA contains two variably used in-frame initiation codons ... 647–651 29 Kahana, C & Nathans, D (1984) Isolation of cloned cDNA encoding mammalian ornithine decarboxylase Proc Natl Acad Sci USA 81, 3645–3649 30 Graham, F.L & van der Eb, A. J (1973) A new technique ... that as part of a complex that is a poor substrate for the 26S proteasome, antizyme is protected from degradation [22] We propose here an alternative possibility, that antizyme is protected from...
Ngày tải lên: 22/02/2014, 04:20
Báo cáo khoa học: "Does Size Matter – How Much Data is Required to Train a REG Algorithm?" potx
... instance? In this paper, we address this question by systematically training the graph-based REG algorithm on a number of “semantically transparent” data sets of various sizes and evaluating on a held-out ... Corpora for Natural Language Generation: Language Generation and Machine Translation (UCNLG+MT), pages 90–92 Ruud Koolen and Emiel Krahmer 2010 The D-TUNA corpus: A Dutch dataset for the evaluation ... Di Fabbrizio, Amanda Stent, and Srinivas Bangalore 2008 Trainable speaker-based referring expression generation In Twelfth Conference on Computational Natural Language Learning (CoNLL2008), pages...
Ngày tải lên: 07/03/2014, 22:20
What is the price of a mousetrap? The assessment of value from cloud services pptx
... The latter has the additional attributes of being available anywhere, at anytime and on any device If it was only a simple as a mouse-trap The complication is that for most customers they already ... customers have this tumour, and they should actively avoid growing it In another ebook, I explain a new business paradigm, Augmented Managed Services (AMS) This is yet another approach businesses ... use when assessing cloud value AMS is the paradigm where a predefined level of demand is managed internally and the remainder augmented with cloud services The apothegm is ‘Own the base and rent...
Ngày tải lên: 09/03/2014, 02:20
Báo cáo khoa học: Long-term extracellular signal-related kinase activation following cadmium intoxication is negatively regulated by a protein kinase C-dependent pathway affecting cadmium transport ppt
... ggauuccugucagugacgauuauua; eGFPsi, gcaagcuga cccugaaguucau; PKCa #1, ccaucggauuguucuuucuucauaa; PKCa #2, gccuccauuugauggugaagaugaa; PKCd #1, ccacu acaucaagaaccaugaguuu; and PKCd #2, ccauccacaagaaaugc aucgacaa ... PKC a 50% decrease in cadmium accumulation, a simultaneous PMA treatment was still able to reduce cadmium accumulation by an additional 30% The simplest explanation is that PMA has a direct negative ... with ClaI–Sse8387I pEGFPN1 and pDSRed-N1 are from Clontech (Mountain View, CA, USA) siRNA sequences are: ZIP8 #1, accuaaagca uuaccugccaucaau; ZIP8 #2, ccgauuucaccuucuucaugauuca; ZIP8 #3, ggauuccugucagugacgauuauua;...
Ngày tải lên: 23/03/2014, 06:20
Commons-based Peer-Production of Physical Goods Is there Room for a Hybrid Innovation Ecology? pdf
... couldn't find any list of where all the fab labs in the world were or what a fab lab was or is it an organisation, is it just a name, is it just a casual name, you know, like a I don't know, and I still ... benefit a large population Another maybe slightly amusing example that initially started in a Fab Lab is the ‘chocolate letter Pi’ Dutch natural scientist Hans Wisbrun combined his fascination as a ... including a bag that collects and replays screams, a computer interface for parrots that can be controlled by a bird's beak, a personalised bike frame, a cow-powered generator, an alarm clock that needs...
Ngày tải lên: 23/03/2014, 10:20
Analyse criterias when there is an m and a and take a company that you know as an example to analyse your criterias analyses
... the regular basis on the combination Geography • • • • Affect adverse selection and moral hazard problems in M &A Hinder acquisitions’ efforts to assess the true value Hamper acquisitions’ ability ... Microsoft and their partners • Nokia brings proven capability and talent in critical areas • Ongoing share growth and the synergies across marketing, branding, and advertising Nokia • Be the best path ... for Information Curious, open to new ideas Quite ambitious Geography Nokia is selling its headquarters in Finland for 170 Microsoft Corporation is an American multinational corporation million...
Ngày tải lên: 08/05/2014, 17:42
Báo cáo hóa học: " Translational Medicine is developing in China: A new venue for collaboration" ppt
... collaboration Xiangdong Wang1*, Ena Wang2, Francesco M Marincola2 Abstract Translational Medicine is an emerging area comprising multidisciplinary Research from basic sciences to medical applications ... science is developing rapidly and widely and, in this article, we will place a special emphasis on China The development of Translational Medicine in China Translational Medicine is an emerging area ... Researchers, ethicists and health care officials from hospitals, academia and governmental agencies, involved in human subject Research, multi-national clinical trials, and Translational “bench-to-bedside”...
Ngày tải lên: 18/06/2014, 16:20
– GED LITERATURE AND THE ARTS, READING PRACTICE QUESTIONS – 61. d. It is ironic that in a place pdf
... polygon has angles that are all equal Angles of a Quadrilateral A quadrilateral is a four-sided polygon Since a quadrilateral can be divided by a diagonal into two triangles, 399 – MEASUREMENT AND ... increased focus on “math in everyday life.” This is emphasized by allowing the use of a calculator on Part I as well as by an increased emphasis on data analysis and statistics As a result, griddedresponse ... vertex, and two rays An acute angle is an angle that measures less than 90 degrees y Acute Angle ■ ray A right angle is an angle that measures exactly 90 degrees A right angle is represented by a square...
Ngày tải lên: 18/06/2014, 17:20
Báo cáo hóa học: " Homologous recombination is unlikely to play a major role in influenza B virus evolution" doc
... in an isolate from a dengue patient J Gen Virol 2007, 88:3334-3340 Wittmann TJ, Biek R, Hassanin A, Rouquet P, Reed P, Yaba P, Pourrut X, Real LA, Gonzalez JP, Leroy EM: Isolates of Zaire ebolavirus ... bootstrap support (data not shown) However, large influenza viral genes in the databases may actually represent assembled artifactual contigs from different but homologous gene segments present in a ... AY582061 PB2 B/Norway/1/84 AF101984 HA B/Memphis/5/93 AF129902 NA B/Memphis/3/93 AF129915 Putative Parents 3SEQ p-value Breakpoint Δ c-AIC B/Shiga/T30/98 B/Alaska/03/1992 B/Guangdong/05/94 B/Chile/3162/2002...
Ngày tải lên: 20/06/2014, 01:20
Cutting Tool Materials What is the use of a book docx
... the plant and to amortise such costs (i.e pay-back), is the most advantageous way forward This strategy can create ‘bottlenecks’ and disrupt the harmonious flow of production at later stages within ... mixture of ‘alpha’ and ‘beta’ , but generally it can be said that as the ‘alpha’ phase increases, the hardness of the ‘Sialon’ becomes greater These chemical and mechanical changes, result in a higher ... different popular coatings may be applicable here, as TiCN coating has a hardness of around 2,700 HV and TiAlN coating has a hardness of approximately 3,200 HV 24 Chapter Figure 12. Ultra-hard cutting...
Ngày tải lên: 27/06/2014, 23:20
Báo cáo y học: "Hyperuricemia and cardiovascular disease: how strong is the evidence for a causal link" docx
... and radical-caused aging and cancer: a hypothesis Proc Natl Acad Sci U S A 1981, 78:6858-6862 51 Sanchez-Lozada LG, Tapia E, Bautista-Garcia P, Soto V, AvilaCasado C, Vega-Campos IP, Nakagawa T, ... nature of the causative association? Is serum urate a direct causative factor for cardiovascular disease? Or is serum urate a cause for factors that are in the causal pathway for cardiovascular ... cardiovascular mortality In 1999 the Framingham Heart Study published the results of their ancillary study on the association of serum urate with cardiovascular disease and cardiovascular death A...
Ngày tải lên: 09/08/2014, 14:22
Is reporting on interventions a weak link in understanding how and why they work? A preliminary exploration using community heart health exemplars docx
... Foundation of Canada and the Canadian Institutes of Health Research), Dr Kothari (Career Scientist Award from the Ontario Ministry of Health and Long Term Care) and Dr Edwards (Nursing Chair funded ... implementation models that allow for contextual adaptation and feedback processes, and mixed methods designs that guide the integrative analysis of quantitative and qualitative findings These all bring into ... programs Such a tool could inform both the design of such research, as well as ensure that important information is available to readers of this literature and to inform systematic analyses across...
Ngày tải lên: 11/08/2014, 05:21
Báo cáo khoa hoc:" Perigraft air is not always pathological: a case report" docx
... negative, and inflammatory markers remained within normal limits As the patient was now apyrexial and continued to be asymptomatic, the decision was made to discharge the patient A repeat CT scan performed ... reconstructive aortic surgery, performing a CT scan at 7, 48 and 102 days post-operatively Only patients had perigraft air at days, and this air had completely resolved by day 28 O'Hara et al looked at 26 ... patients, scanning them on days 3, and 52 Seventeen patients had perigraft air on day 3, and seven on day No patient had residual perigraft air on the final scan There is however no data regarding...
Ngày tải lên: 11/08/2014, 10:22
Báo cáo y học: "Development of bone marrow lesions is associated with adverse effects on knee cartilage while resolution is associated with improvement - a potential target for prevention of knee osteoarthritis: a longitudinal study" pdf
... individual cartilage plates (medial and lateral tibia) were measured from the total volume by manually drawing disarticulation contours around the cartilage boundaries on each section on a workstation ... Potential confounders of age, gender, BMI, and tibial plateau area for annual change in cartilage volume were included in multivariate analyses A P value less than 0.05 (two-tailed) was regarded as ... Sowers MF, Hayes C, Jamadar D, Capul D, Lachance L, Jannausch M: Magnetic resonance-detected subchondral bone marrow and cartilage defect characteristics associated with pain and x-ray defined...
Ngày tải lên: 12/08/2014, 11:22
Báo cáo y học:" is supra-ventricular arrhythmia a reason for the bad performance of the FlowTrac device" pot
... regarding the validity of the uncalibrated arterial waveform analysis cardiac output (COWave) in a medical intensive care unit patient In our study we found a good correlation of aortic transpulmonary ... Critical Care Vol 11 No Umgelter et al Authors’ response Michael Sander, Claudia D Spies, Achim Foer and Christian von Heymann We read with interest that Umgelter and colleagues confirmed our data ... transpulmonary thermodilution cardiac output (COTranspulm) and pulmonary artery catheter thermodilution cardiac output (COPAC) measurements prior to, during, and after coronary artery bypass graft surgery...
Ngày tải lên: 13/08/2014, 03:20
Báo cáo y học: "Human cyclin T1 expression ameliorates a T-cell-specific transcriptional limitation for HIV in transgenic rats, but is not sufficient for a spreading infection of prototypic R5 " ppt
... sequence in tail biopsy DNA samples (5'primer: GAT ACT AGA AGT GAG GCT TAT TTG, 3'-primer: CAG ATA GTC ACT ATA AGG ACG AAC) and selected for further matings with n-tg Sprague-Dawley rats Transgene ... already macrophages from n-tg rats are at a level comparable to human MDM This may, in part, relate to the ability of HIV-1 to exploit a distinct set of nuclear transcription factors and alternative ... expression was comparable and statistically indistinguishable for infected macrophages derived from n-tg rats and MDM from human donors [3] Here, hCycT1 transgenesis did not have an enhancing effect...
Ngày tải lên: 13/08/2014, 05:21
Bóa cáo y học: "Is the value of a life or life-year saved context specific? Further evidence from a discrete choice experiment" ppt
... of Australia; 2002 ABS: Australian Bureau of Statistics (ABS) National Health Survey 2004– 05: Summary of Results (Catalogue No 4364.0) Canberra: Commonwealth of Australia; 2006 ABS: Australian ... Understanding Statistics 2002, 1:223-31 ABS: Australian Bureau of Statistics (ABS) Population by Age and Sex Australian States and Territories (Catalogue No 3201.0) Canberra: Commonwealth of Australia; ... to pay Table summarises marginal effects for lives saved population-average model Marginal effects were calculated at the median for each attribute and reflect a discrete change between categories...
Ngày tải lên: 13/08/2014, 11:22