... float: Table: Some of aquatic plants popular Type Aquatic plant live sink Scientific name Hydrilla verticillata Myriophyllum spicatum Blyxa aubertii Eichhornia crassipes Aquatic plant Wolfia arrhiga ... arrhiga live drift Pistia stratiotes Salvinia spp Typha spp Aquatic plant Scirpus spp live float Phragmites communis Jussiaea repens L 2.2 Some of aquatic plants in Mekong delta - Aquatic plant ... CHAPTER 2: TREATMENT WASTE WATER IN BREEDING BY AQUATIC PLANT -o0o 2.1 Classification aquatic plant: 2.1.1 Aquatic plant live sink: 2.1.2 Aquatic plant live drift: 2.1.3 Aquatic plant live...
Ngày tải lên: 15/01/2016, 16:17
Ngày tải lên: 20/02/2015, 10:06
Báo cáo y học: "Eosinopenia is a reliable marker of sepsis on admission to medical intensive care units"
... 36 and health-related quality of life after intensive care in Morocco Acta Anaesthesiol Scand 2007, 51:189-197 A ssaoui Y, Zeggwagh AA, Zekraoui A, Abidi K, Abouqal R: Validation of a behavioral ... presented as the mean ± standard deviation for variables with a normal distribution, and as the median and interquartile range for variables with skewed distributions Parametric or nonparametric ... drafted the manuscript and participated in the acquisition of data and the study design JB participated in the acquisition of data NM helped to draft the manuscript, and participated in the acquisi-...
Ngày tải lên: 25/10/2012, 10:35
A RUSH OF BLOOD TO THE HEAD
... Mumbai The next day São Paolo Or Dublin, Tokyo, Edinburgh, San Francisco, Athens, Lima, Sri Lanka, or Shanghai But my hectic travel schedule is an advantage I can bring to a team that’s usually too ... replied, adding that the statistical validity was as solid as could be But this wasn’t half as amazing as what Dr Calvert discovered once she analyzed the results further Cigarette warnings—whether ... soft-pedaled American warnings European cigarette makers place their warnings in coal-black, Magic Marker–thick frames, making them even harder to miss In Portugal, dwarfing the dromedary on Camel packs,...
Ngày tải lên: 17/10/2013, 18:20
Tài liệu ECTS Users’ Guide: Europe Direct is a service to help you find answers to your questions about the European Union doc
... It is recommended that in either case components should not be too small, to avoid fragmentation of a programme It is also advised not to make components too large, as that may inhibit interdisciplinary ... implement the Standards and Guidelines for Quality Assurance in the European Higher Education Area.22 their programmes and awards.23 The quality assurance of programmes and awards is expected to include: ... might use a European grading scale as a translation device into other grading systems Such European scale was based on the statistical distribution of passing grades in each pro- As a second step...
Ngày tải lên: 16/02/2014, 03:20
Tài liệu Báo cáo khoa học: Stimulation of poly(A) synthesis by Escherichia coli poly(A)polymerase I is correlated with Hfq binding to poly(A) tails ppt
... 5¢-GCTTCAGTACTTAGAGAC 5¢-TAATACGACTCACTATAGGGAGACGTAGCACGTTACACC 5¢-GAAAAAAGGGGCCACTCAGG 5¢-T(18)GAAAAAAGGGGCCACTCAGG 5¢GCGTCGCTAATTCTTGCGAGA18TTTCAGAAAAGGGCTG 5¢-C(18)GAAAAAAGGGGCCACTCAGG 5¢-G(18)GAAAAAAGGGGCCACTCAGG ... Forward Reverse Reverse Reverse Forward Reverse 5¢-TAATTAACCCTCACTAAAGGGGTGCTCGGCATAAG 5¢-GCCATGAATATCTCCAACGAG 5¢-CATCCAAAATACGCCATGAATATC 5¢-TAATACGACTCACTATAGGGGCCGCTTAACGTCGCG 5¢-GCTTCAGTACTTAGAGAC ... 5¢-G(18)GAAAAAAGGGGCCACTCAGG 5¢-GAATTGCTGCCGTCAGCTTGA 5¢-TAATTAACCCTCACTAAAGGGAAACGGAGCGGCACCTCTT 5¢-GCGGATCCTGGACCGCAAAAG ompA* ompA105 ompA117 5¢rpsO 5¢rpsO 3¢rpsO 3¢rpsO 3¢rpsO-(T)18 rpsO internal 3¢rpsO-(C)18...
Ngày tải lên: 19/02/2014, 16:20
Báo cáo khoa học: Tumor necrosis factor-a converting enzyme is processed by proprotein-convertases to its mature form which is degraded upon phorbol ester stimulation pptx
... following antibodies were used: anti-ADAM10, a polyclonal rabbit antibody against endogenous ADAM10 and anti-TACE, and a polyclonal rabbit antibody against endogenous TACE (Chemikon International, ... 25–31 Takahashi, S., Kasai, K., Hatsuzawa, K., Kitamura, N., Misumi, Y., Ikehara, Y., Murakami, K & Nakayama, K (1993) A mutation of furin causes the lack of precursor-processing activity in human ... (5¢-GTGGGCCGGAAAGTGAGCCA-3¢) and Fur2_rev (5¢-CCCTTGTAGGAGATGAGGCC-3¢) The resulting 1058 bp amplificate was isolated, subcloned in pUC57 (MBI Fermentas) and sequenced Western blot analysis of TACE and ADAM10...
Ngày tải lên: 08/03/2014, 02:20
Báo cáo khoa học: Enzymatic oxidation of NADP+ to its 4-oxo derivative is a side-reaction displayed only by the adrenodoxin reductase type of ferredoxin-NADP+ reductases potx
... withdrawn, AMP was added as internal standard, and samples were analyzed by ion exchange chromatography as described above The amount of NADPO was determined on the basis of peak integration data ... class of enzymes, we assayed Toxoplasma gondii FNR [11], Plasmodium falciparum FNR [12] and spinach (Spinacia oleracea) leaf FNR [13] (which all are planttype FNRs) for their ability to catalyze ... transfer rate from NADPH or NADH to the enzyme-bound FAD [5] Here, we have assayed FprAE21 4A and FprA-H57Q for their ability to catalyze NADP+ oxidation to NADPO As shown in Fig 6, both mutant...
Ngày tải lên: 16/03/2014, 11:20
Báo cáo Y học: Incorporation of 3-nitrotyrosine into the C-terminus of a-tubulin is reversible and not detrimental to dividing cells potx
... antisera were usually collected 15 days after each injection and tested for affinity and specificity and stored at )20 °C Mouse monoclonal antibodies against Tyr-tubulin (Tub 1A2 ) and total a- tubulin ... scanned with a Duoscan T1200 (Agfa) connected to a PC, and optical density values determined using the Scion Image program Experimental values were standardized relative to total tubulin loaded, by ... preparations were processed to compare the abilities of tyrosinated and nitrotyrosinated tubulin to assemble into and to disassemble from microtubules, by monitoring radioactivity and immunoreactivity...
Ngày tải lên: 17/03/2014, 10:20
Báo cáo Y học: A Ca2+/CaM-dependent kinase from pea is stress regulated and in vitro phosphorylates a protein that binds to AtCaM5 promoter ppt
... same promoter fragment The sequences of the oligonucleotides used for these experiments are: Oligo I, 5¢-CAAGGACGTTCGATGCA CTTCCAAAAAACATATAAT-3¢; Oligo II, 5¢-CAAT GTAGTATTAAAAAGTAGTAGTTAAAAGC-3¢; ... PCR reaction with AtCaM5 primers (forward primer: 5¢-GATGTTGATGGTGATGGTCA-3¢; reverse primer: 5¢-AAACCAGCCATGAATGAAAT-3¢) and with actin primers (forward primer: 5¢-GTTGGGAT GAACCAGAAGGA-3¢; ... temperature, but not salinity-stimulated kinase level is mediated via a Ca2+/CaM pathway To further confirm that the upregulation of PsCCaMK by NaCl and low temperature is mediated via a Ca2+/CaM...
Ngày tải lên: 18/03/2014, 01:20
How to Write a Marketing PlanThe Marketing Plan is a highly detailed, heavily researched pdf
... Situational Analysis) so readers of the plan can easily compare what was planned to what is planned Part 4: Tactical Marketing Programs Target Market Issues If the target market remains the same as what ... target market approach: o What general strategy is used to reach targeted customers? Generally approaches include: mass market – aim to sell to a large broad market segmentation approach – aim ... information can be handled within a graphical format, such as tables and graphs, though a paragraph explanation of each is generally required Make sure to include total dollar (or other currency) amounts...
Ngày tải lên: 22/03/2014, 14:20
Báo cáo khoa học: The leech product saratin is a potent inhibitor of platelet integrin a2b1 and von Willebrand factor binding to collagen pdf
... molecules, LAPP (an approximately 13 kDa leech antiplatelet protein isolated from Haementeria officinalis) and calin and saratin (approximately 65 kDa and 12 kDa proteins, respectively, both isolated ... MM (2001) Saratin, an inhibitor of von Willebrand factor-dependent platelet adhesion, decreases platelet aggregation and intimal hyperplasia in a rat carotid endarterectomy model J Vasc Surg 34, ... respect to platelet adhesion ⁄ surface area on untreated fibrillar or soluble collagen, respectively antagonists to VWF receptors on platelets, namely the mAb to GPIb, 6D1, and the mAb to aIIbb3,...
Ngày tải lên: 30/03/2014, 09:20
Báo cáo sinh học: " High Chromosome Number in hematological cancer cell lines is a Negative Predictor of Response to the inhibition of Aurora B and C by GSK1070916" potx
... Nishioka C, Tasaka T, Taniguchi A, Kuwayama Y, Komatsu N, Bandobashi K, Togitani K, Koeffler HP, et al: AZD1152, a novel and selective aurora B kinase inhibitor, induces growth arrest, apoptosis, ... primary blasts Haematologica 2008, 93:662-669 34 Sharma SV, Haber DA, Settleman J: Cell line-based platforms to evaluate the therapeutic efficacy of candidate anticancer agents Nat Rev Cancer ... Yang J, Adachi Y, Nishioka C, Furihata M, Koeffler HP, Yokoyama A: Analysis of Aurora B kinase in non-Hodgkin lymphoma Lab Invest 2009, 89:1364-1373 Ikezoe T, Yang J, Nishioka C, Tasaka T, Taniguchi...
Ngày tải lên: 18/06/2014, 22:20
báo cáo hóa học: " How useful is satellite positioning system (GPS) to track gait parameters? A review" docx
... EE, Rutschmann B, Najafi B, Aminian K: Ambulatory system for the quantitative and qualitative analysis of gait and posture in chronic pain patients treated with spinal cord stimulation Gait Posture ... there is no warranty that environmental changes (slope, quality of the terrain) or pathological gait (for instance claudication) are correctly taken into account As a result, investigators must carefully ... gait variability analysis, provided that the potential user is aware of the different constraints In this context, table summarizes the advantages and drawbacks of GPS Regarding the technical and...
Ngày tải lên: 19/06/2014, 10:20
o cáo hóa học:" High Chromosome Number in hematological cancer cell lines is a Negative Predictor of Response to the inhibition of Aurora B and C by GSK1070916" ppt
... Nishioka C, Tasaka T, Taniguchi A, Kuwayama Y, Komatsu N, Bandobashi K, Togitani K, Koeffler HP, et al: AZD1152, a novel and selective aurora B kinase inhibitor, induces growth arrest, apoptosis, ... primary blasts Haematologica 2008, 93:662-669 34 Sharma SV, Haber DA, Settleman J: Cell line-based platforms to evaluate the therapeutic efficacy of candidate anticancer agents Nat Rev Cancer ... Yang J, Adachi Y, Nishioka C, Furihata M, Koeffler HP, Yokoyama A: Analysis of Aurora B kinase in non-Hodgkin lymphoma Lab Invest 2009, 89:1364-1373 Ikezoe T, Yang J, Nishioka C, Tasaka T, Taniguchi...
Ngày tải lên: 20/06/2014, 04:20
báo cáo hóa học:" Is there added risk in resurfacing a femoral head with cysts?" ppt
... year, two years, and every other year afterward Harris hip score (HHS), UCLA activity score, and visual analogue scale (VAS) pain score were evaluated at every follow-up visit Complications and ... femoral failures are particularly high in a certain group of patients, they may be considered poor candidates for HRA If the alternative risks of amputating the femoral head and neck to perform a ... of 117 patients was compared to a control group that was computer matched for factors that have been proposed as risk factors for early femoral failure (see Table &3) In addition, UCLA activity...
Ngày tải lên: 20/06/2014, 07:20
Báo cáo hóa học: " Our vision for this new SpringerOpen Access journal, Psychology of Well-Being: Research, Theory and Practice, is to promote a distinctly eclectic approach to investigating well-being. When the prospect of " pdf
... individuals across the lifespan and across the globe This is an inter-disciplinary task The scientific research community is considerably more accepting of well-being studies today than it was several ... dedicated to well-being research, many of whom we are fortunate to have on our editorial board Several of the major achievements occurring over the past decade were facilitated by the formation of ... work has been instrumental in understanding the factors that are associated with well-being For example, we now have considerable insight into the role of personality and sociodemographic factors...
Ngày tải lên: 21/06/2014, 06:20
101 Ways to Market Your Business 101 Ways to Market Your Business is a collection of marketing pptx
... clients Learn sales ideas from reading and studying other business advertising and marketing material Educate yourself with new strategies Form a strategic business alliance that allows you to share ... price, packaging, delivery, benefits, quality, performance, features, availability, extras, service, proof and guarantees Join an affiliate programs “Pay per Sale” Exchange articles and content ... instead of mass media advertising Personalise all your email messages so that they all get read Using the person’s name is essential Follow up regularly with all your clients and potential clients...
Ngày tải lên: 28/06/2014, 12:20