... Total IgE Total IgE Specific IgE, wheeze FEV1 Atopic dermatitis None Total IgE Caucasian Caucasian Caucasian Caucasian British/Australian Japanese American Australian Caucasian Japanese Caucasian ... Kuehr J, Hopkin JM, Shirakawa T, Deichmann KA: The Ile198Thr and Ala379Val variants of plasmatic PAF-acetylhydrolase impair catalytical activities and are associated with atopy and asthma Am J Hum ... Yes No No No Japanese Caucasian Japanese Australian/Venezuelan Mixed Caucasian Japanese Not specified Japanese Italian Japanese American American Italian Japanese German Japanese Japanese Reference...
Ngày tải lên: 12/08/2014, 18:20
... characterization and examination of this relationship, we introduce the BIS, an agent-based model (ABM) based on the cellular and molecular mechanisms of the interface between the innate and adaptive ... that mediate damage associated with psoriasis and the secondary phase of type IV hypersensitivity reactions such as atopic dermatitis Interestingly, inflammatory dendritic epidermal cells and increases ... 108; and 100 DCs, n = 103 A technique has been reported to eliminate alveolar macrophages in mice, and these mice exhibit a significantly increased adaptive response to intra-tracheally administered...
Ngày tải lên: 13/08/2014, 16:21
UNDERSTANDING THE INTERACTIONS BETWEEN VEGETATION AND HYDROLOGICAL SYSTEMS IN TROPICAL URBAN AREAS FOR SUSTAINABLE WATER RESOURCES MANAGEMENT
... Fagraea frangrans, Samanea saman and Casuarina nobilis) in January 2000 The throughfall 31 measurements in Vancouver are from Asadian and Weiler (2009) in the district of North Vancouver for Douglas-fir ... relevant than rainfall intensity and duration Furthermore, rainfall depth is the combination of rainfall intensity and duration and thus one variable of rainfall depth partially incorporates information ... weather station located in National University of Singapore Kent Ridge campus and managed by Department of Geography Data in Vancouver is from the Canada National Climate Data and Information Archive...
Ngày tải lên: 09/09/2015, 08:18
Co operation between humoral and cellular immunity in pulmonary lung inflammation
... serum samples were prepared in assay diluent The plate was washed five times and after the last wash, any remaining wash buffer was removed by inverting the plate and blotting against clean paper ... watermark Materials and Methods 34 step, samples and standards are prepared Aspiration/wash was repeated as in step 50µl of sample or standards in reagent diluent were added to each per well and ... animal and was maintained in that position for 20 seconds If the animal had sneezed out the inoculum, it was put back into the anaesthesia chamber and i.n was attempted again It was important that...
Ngày tải lên: 03/10/2015, 21:57
Báo cáo y học: "Between adaptive and innate immunity: TLR4-mediated perforin production by CD28null T-helper cells in ankylosing spondylitis" pptx
... rheumatoid factor and anti-cyclic citrullinated peptide antibodies, HLA-B27 status, axial involvement, erythrocyte sedimentation rate and C-reactive protein) are summarized in Table Nine of the AS ... 5'-CTGAGCCTCGTCCATGGGCCACTCC-3'; TLR4: forward, 5'TGCAATGGATCAAGGACCAGAGGC-3'; reverse, 5'GTGCTGGGACACCACAACAATCACC-3'; and β2 microglobulin: forward, 5'-CTCCGTGGCCTTAGCTGTG-3'; reverse, 5'-TTTGGAGTACGCTGGATAGCC-3') ... test and the Wilcoxon test were used as appropriate At least six assays were performed for each experiment P < 0.05 was considered significant and P < 0.01 was highly significant Data are shown as...
Ngày tải lên: 09/08/2014, 07:20
Báo cáo y học: " Interactions between xenoestrogens and ketoconazole on hepatic CYP1A and CYP3A, in juvenile Atlantic cod (Gadus morhua)" ppsx
... membrane and immunoblotted for CYP 3A, as described above Catalytic assays The CYP 1A activity was determined as EROD activity, using resorufin as standard in a SpectraFluor plate reader according ... al [58] The CYP 3A catalytic activity was measured as BFCOD activity, using HFC as standard The BFC assay was performed based on a published protocol by Miller et al [59] and optimized for rainbow ... CYP 1A and CYP 3A enzymes, in juvenile Atlantic cod (Gadus morhua) Imidazoles and triazoles are used as fungicides both clinically as well as in horticulture and agriculture, posing a potential...
Ngày tải lên: 13/08/2014, 13:20
Báo cáo y học: " Interactions Between Estrogen- and Ah-Receptor Signalling Pathways in Primary Culture of Salmon Hepatocytes Exposed to Nonylphenol and 3,3'''',4,4''''-Tetrachlorobiphenyl (Congener 77)" ppsx
... TCCAGGAGCTGTCTCTCCAT GAGCATCCAAGGTCACAATG AAGCCACCTCCAATGTCATC TGACGAAGGTCCTCAGGG GGGATACGCACAGACACCTT AGGGGCGTCTGAAGTTCC GACCCCCAGGACCAGAGT TTCCTCCAGGGACAGAAGAA AGAGCAATCCCAGGGTCC GAGTTTGGGCAGGTGGTG ... GGGAGTCTGTCCCAAGACAA AGGGTTTGGGGTTGTGGT CCCAGATTCCACAGACACCT GTGAACAGGCCCAACCTG GTTGTCCTGGATGACGGC ATGGAGGGCAGCAGAAGAG TGGGAGGGTGATTGAGGA TGGTGCGGTTTGGTAGGT ATCCAGTTGAGGTCGTGAGC CATACAAAGCTGGTGGCTCA GenBank ... grant to ASM We thank Solveig Gaasø at Marine Harvest Norway AS for supplying the experimental fish We are grateful to Marte Braathen for assistance during sampling http://www.comparative-hepatology.com/content/6/1/2...
Ngày tải lên: 13/08/2014, 13:20
Tài liệu Báo cáo khoa học: Long-distance interactions between enhancers and promoters The case of the Abd-B domain of the Drosophila bithorax complex pdf
... curved arrows) of the cis and trans interactions in favor of the latter An increase in the trans interaction results in an increase in the level of the functional Abd-B protein Continuous lines ... and by the Hungarian National Granting Agency, OTKA L S is supported by an NIH FIRCA grant References ´ Casanova J, Sanchez-Herrero E & Morata G (1986) Identification and characterization of a ... iab regulatory regions and abdominal -A and Abdominal-B Drosophila melanogaster Genetics 139, 835–848 19 Zhou J, Ashe H, Burks C & Levine M (1999) Characterization of the transvection mediating...
Ngày tải lên: 20/02/2014, 01:20
Tài liệu Interactions Between Workers and the Technology of Production: Evidence from Professional Baseball doc
... related papers to ours are by Ichino and Maggi (2000) and Mas and Moretti (2006) Ichino and Maggi (2000) examine shirking behavior within a large banking firm, and show that a worker’s shirking ... the standard deviation in a player’s batting average (0.039 in Table 1) The predicted change in a batter’s batting average due to a two standard deviation change in the team’s pitching ERA would ... significant, and appear to be based on a rational response to the technology The Data and Background The data was obtained from the “Baseball Archive” which is copyrighted by Sean Lahman, and is a freely...
Ngày tải lên: 22/02/2014, 09:20
Báo cáo khoa học: Interactions between metals and a-synuclein ) function or artefact? pptx
... 120–129 34 Tobe T, Nakajo S, Tanaka A, Mitoya A, Omata K, Nakaya K, Tomita M & Nakamura Y (1992) Cloning and characterization of the cDNA encoding a novel brain-specific 14-kDa protein J Neurochem ... of alpha-synuclein in rat substantia nigra results in loss of dopaminergic neurons, phosphorylation of alpha-synuclein and activation of caspase-9: resemblance to pathogenetic changes in Parkinson’s ... D, Mandir AS, Dawson TM, Copeland NG, Jenkins NA & Price DL Interactions between metals and a- synuclein 49 50 51 52 53 54 55 56 57 58 (2002) Human alpha-synuclein-harboring familial Parkinson’s...
Ngày tải lên: 07/03/2014, 10:20
Báo cáo khoa học: Identification, subcellular localization and functional interactions of PilMNOWQ and PilA4 involved in transformation competency and pilus biogenesis in the thermophilic bacterium Thermus thermophilus HB27 ppt
... that PilM is exclusively located in the inner membrane PilM contains a conserved C-terminal ATPase domain of actin-like ATPases, such as FtsA and MreB, which are involved in cell division and ... PilA4-comprising DNA translocator complex, spanning the outer membrane and periplasmic space, whereas PilM, PilN and PilO are inner membrane proteins that probably form part of the assembly platform and are ... and PilA4 to stably localize or accumulate in the outer membrane are strongly dependent one another, indicating interactions between PilW, PilQ and PilA4 in structure and assembly FEBS Journal...
Ngày tải lên: 07/03/2014, 12:20
Báo cáo khoa học: "Disambiguating Between Generic and Referential “You” in Dialog ∗" ppt
... two-party data is reasonable, and we see promising results on multiparty data with a basic set of features We expect the accuracy to go up once we train and test on samegenre data and also add features ... conversations, yielding 85 utterances containing “you”; the task was reported to be easy, and the kappa was 100% We then annotated a total of 42 conversations for training and 13 for testing Different ... this feature alone to cause an increase in overall accuracy Error Analysis We performed an error analysis on our best classifier output on the training set; accuracy was 94.53%, giving a total of...
Ngày tải lên: 08/03/2014, 03:20
Báo cáo khoa học: In vitro analysis of the relationship between endonuclease and maturase activities in the bi-functional doc
... 5¢-AGCTTGTTACAG-AGAAACCTCCTCATG-3¢; AnI17R 5¢-AATTCACGAGGAGGTTTCTCTGTACTA-3¢; AnI17H 5¢-AGCTTAGTACAGAGAAACCTCCTCG TG-3¢; AnI15R 5¢-AATTCACAGGAGGTTTCTCT-GTC TA-3¢; AnI15H 5¢-AGCTTAGACAGAGAAACCTCC ... time using a nitrocellulose filter binding assay as described above A control reaction that did not contain a chase was also performed Adding both DNAs simultaneously gave a negligible signal above ... °C and were visualized by autoradiography RNA splicing assays Single- and multiple-turnover protein-assisted RNA splicing assays were performed in TK8 buffer containing mM MgCl2, 0.2 U RNA-Guard...
Ngày tải lên: 17/03/2014, 10:20
Báo cáo khoa học: Structural and mutational analyses of protein–protein interactions between transthyretin and retinol-binding protein doc
... F and the Fab chains H and L [left side, color codes as in (A) ] Center and right drawings show the interacting surfaces of RBP (center) and Fab (right), rotated through a vertical axis by approximately ... Table Contacts between amino acid residues in the RBP–TTR– ˚ Fab complex characterized by interatomic distances within 4.0 A: interactions between RBP and Fab Interactions were analyzed using the ... sequences of the variable domains of L and H chains of the antibody A8 P3 are provided in Fig S1 Binding assay for the interaction between holoRBP and TTR variants To study the in vitro interaction of...
Ngày tải lên: 30/03/2014, 02:20
NONLINEARITIES BETWEEN ATTITUDE AND SUBJECTIVE NORMS IN INFORMATION TECHNOLOGY ACCEPTANCE: A NEGATIVE SYNERGY?1
... high, increases in attitude had a decreasing marginal impact on IT use intentions, and when attitude was high, increases in subjective norms had a decreasing marginal impact on usage intentions Also, ... of Interaction and Non-linear Modeling,” in Interaction and Nonlinear Effects in Structural Equation Modeling, R E Schumacker and G A Marcoulides (eds.), Mahwah, NJ: Lawrence Erlbaum Associates, ... term was significant, indicating that the interaction was not spurious and that quadratic terms did not inflate its significance and reliability (Carte and Russell 2003; Ping 2004; Venkatraman 1989)...
Ngày tải lên: 08/04/2014, 18:33
báo cáo hóa học: " The agreement between workers and within workers in regard to occupational exposure to mercury in dental practice assessed from a questionnaire and an interview" potx
... expressed as kappa statistics between the questionnaire and the interview in regard to ever having used copper amalgam, performed manual mixing in a mortar, and used a Dentomat Taking the answers ... questionnaire and the interview respectively was also calculated in the same way Cohen’s kappa statistic was used as a measure of the within worker agreement between the questionnaire and the interview ... that was manually mixed in a mortar? yes-no Have you ever manually weighted mercury and alloy and mixed it in a mortar? If yes: In that case, when and for how many years? From year to year Have...
Ngày tải lên: 20/06/2014, 00:20
Báo cáo hóa học: " Research Article Analysis of the Tradeoff between Delay and Source Rate in Multiuser Wireless Systems" docx
... Theorem can be applied and Cu [n] can be considered a Gaussian random variable with average n · mu and variance n · 2 σu , where mu and σu are the mean and the variance of cu [n], the instantaneous ... BC and uncorrelated channel: maximum achievable rate of the median user Average SNR following lognormal shadowing with mean 10 dB and standard deviation dB ε = 0.1 βu = average 10 dB and standard ... by the MAC layer: a selected scheduling discipline and a QoS constraint given in terms of a delay constraint and a BER The delay constraint consists of a target delay Dt and the probability of...
Ngày tải lên: 21/06/2014, 11:20
Interactions between Aquaculture and the Environment pot
... new pathways and new invasions are still being discovered in diverse coastal areas, often at a stage when invaders are already well established and the response to date has been inadequate, and ... marine-based activities and uses Impacts of invasive marine species can be dramatic and are usually irreversible Introduced invasive marine species might have consequences as negative as collapsing ... vectors of introduced marine species are ballast water and fouling, aquaculture has also been pointed out as an important vector for the arrival of alien species to coastal areas Approximately 17...
Ngày tải lên: 29/06/2014, 02:20
Báo cáo lâm nghiệp: "Relationships between site and stock quality in Pinus halepensis Mill. reforestation on semiarid landscapes in eastern Spain" ppsx
... Campo A. , Cortina J., Factores que afectan al éxito de una repoblación y su relación la calidad de la planta, in: Cortina J et al (Eds.), Calidad de planta forestal para la restauración en ambientes ... organic matter content, alkaline pH and with active calcium carbonate in the fine soil fraction The climate is Mediterranean continental to maritime with a maximum rainfall in early autumn and a minimum ... Ca Ca,Ht Ca,Ht,Ip Ca,Ip Ca,Ht,Ip Ca*,Ht*,Ip Ca*, Ht,Ip All* Ca*,Ip All* Ca Ca-,HtCa IpCa,Ht, Ca-,Ht*Ca-,IpCa,Ht,Ip Ca*,Ht,Ip* Ca,Ht,Ip HtCa,Ht,Ip Ca-,Ht*-,IpCa-,IpCa Ca*,Ht,Ip Ca Ca*- Ca Ca Ca...
Ngày tải lên: 07/08/2014, 16:21
Báo cáo lâm nghiệp: "Growth trends reveal the forest structure during Roman and Medieval times in Western Europe: a comparison between archaeological and actual oak ring series (Quercus robur and Quercus petraea)" pot
... (BAI) instead of the ring width The basal area is defined as the area of the cross-section of a tree stem near the base, generally measured at breast height The BAI is then defined as the increase ... increase in basal area of a tree over a specified time period (e.g one growing season) Ring-width series can be converted to annual basal area increments (BAIi; Eq (2)) assuming that the growth rings ... rates in the first cambial age class (a cambial age of to 10 years, starting from the pith) After they reached an age of ca 20 years the growth rate rapidly decreases, and tends to stabilize at...
Ngày tải lên: 08/08/2014, 00:22