integration of molecular and cellular pathogenesis a bioinformatics approach

... dominated by randomness (and fractal and chaos) rather than by our familiarity of a traditional 'Euclidean orderliness' This is not a law like gravity but, instead, a principle having a statistical ... specialized journals Thermal Analysis and Calorimetry (JTAC) and Thermochimica Acta (TCA), which cover the entire field of thermal analysis and related thermophysical studies, and which naturally ... (collections of carefully evaluated and recommended data), storage in data banks, and dissemination of these data to end users (educational institutions and basic scientific and applied research centers),...

Ngày tải lên: 06/07/2014, 15:28

... epimerase from spider venom J Org Chem 67, 8389–8394 14 Shikata Y, Watanabe T, Teramoto T, Inoue A, Kawakami Y, Nishizawa K, Katayama K & Kuwada M (1995) Isolation and characterization of a peptide ... VIH I After similar cleavage of VIH II by endo-Asp-N and RP-HPLC, MS analysis indicated that a peptide with a molecular mass of 795.9 Da was eluted at 31.5 (i.e later than Hep-l, Hep-dA3 and Hep-dF5; ... pig and recognizing both VIHs) [45] were used as primary antisera (Table 3) Secondary antibodies (anti-rat IgG, anti-guinea pig IgG and anti-rabbit IgG; all raised in goat and conjugated to alkaline-phosphatase;...

Ngày tải lên: 18/02/2014, 11:20

... In addition, activation of phospholiase A2 and subsequent release of arachidonic acid may inhibit transporter-mediated glutamate uptake from the extracellular space.33,172,173 Among several Ca2+-activated ... nucleotide translocator ligand atractylate induce permeability transition and opening of the megachannel, whereas Mg2+, antioxidants, ADP, cyclosporin A and the adenine nucleotide translocator ligand ... Application of a p38 MAP kinase inhibitor significantly attenuated NO-induced caspase activation, Bax translocation, and neuronal cell death 274 EXCITOTOXICITY, CALCIUM LOADING AND APOPTOSIS A great...

Ngày tải lên: 08/04/2014, 12:51

... this article as: Orlandi et al.: Molecular and cellular correlates of the CIITA-mediated inhibition of HTLV-2 Tax-2 transactivator function resulting in loss of viral replication Journal of Translational ... Kretsovali A: Acetylation by PCAF enhances CIITA nuclear accumulation and transactivation of major histocompatibility complex class II genes Mol Cell Biol 2000, 20:8489-8498 Kanazawa S, Takashi ... de-regulation of several steps both at transcriptional and post-transcriptional level [17] Tax activates transcription of many cellular genes, including interleukin-2 (IL-2) and IL-2Ra [18,19] and affects...

Ngày tải lên: 18/06/2014, 22:20

... this article as: Orlandi et al.: Molecular and cellular correlates of the CIITA-mediated inhibition of HTLV-2 Tax-2 transactivator function resulting in loss of viral replication Journal of Translational ... Kretsovali A: Acetylation by PCAF enhances CIITA nuclear accumulation and transactivation of major histocompatibility complex class II genes Mol Cell Biol 2000, 20:8489-8498 Kanazawa S, Takashi ... de-regulation of several steps both at transcriptional and post-transcriptional level [17] Tax activates transcription of many cellular genes, including interleukin-2 (IL-2) and IL-2Ra [18,19] and affects...

Ngày tải lên: 20/06/2014, 04:20

... AGAAAGCTGGGTCATCTAAAGTGATTGTGAGGA 740 AAAAAGCAGGCTTGAAAAATTGTGAG AGAAAGCTGGGTCATCTAAAGTGATTGTGAGGA 360 AAAAAGCAGGCTCGGAACTCCACAAG AGAAAGCTGGGTCATCTAAAGTGATTGTGAGGA 1027 AAAAAGCAGGCTGCCCCAAATGACACCTTA AGAAAGCTGGGTCATTGTTAAGAGTTAGAATTTG ... AAAAAGCAGGCTTGCACAGAGGCAAACATATATTT AGAAAGCTGGGTCATTGTTAAGAGTTAGAATTTG AGAAAGCTGGGTCATTGTTAAGAGTTAGAATTTG AGAAAGCTGGGTCATTGTTAAGAGTTAGAATTTG 334 AAAAAGCAGGCTCAACGCAAGTTAACC 133 AAAAAGCAGGCTCAGCATGTGCACTTCCACCT ... 1894 AAAAAGCAGGCTTCATGGAGTTCATCAAAGCAAAG 2129 AGA AAGCTGGGTCAGGAGTACACTTTTTAT 1894 AAAAAGCAGGCTTCATGGAGTTCATCAAAGCAAAG 1895 AGAAAGCTGGGTCTTAAGGAGTACACTTTTTATC OnTI2 1892 1893 AAAAAGCAGGCTTCATGGAGCTCATCAAATCATCA...

Ngày tải lên: 11/08/2014, 11:21

... Ywhah ACCCTTGCTCGTTCTAGTGC CCACCACACTTGCTTTCCTT TTTGGGTGTACGTCCTGACA ATTGCCTTTGTCGATTGGTC AGCAGGGAAGGAAGGTCATT CTTACAGCCGTTTGCCTAGC AGCCGACTTAGGAAGGAAGC AGGTCCCCGTAGGTATGTCC GGTTTCGCTCCCACAAGAT ... AGGTCCCCGTAGGTATGTCC GGTTTCGCTCCCACAAGAT GGAATCCAAATGCACAGCTT CAGCTCCTCCACTCGAGACT TCGGAAGGAAAGCTGCTCTA GGCGTTCTCACCTACGAGTC CCGTTTTGAACATGGAAAGC GTCTCGGAGCCCACTGTAAG CCCAGCCCTAACGGTCTT 224 583 486 228 529 ... Organization Figure Overview of microarray analysis, annotation, and promoter analysis Overview of microarray analysis, annotation, and promoter analysis A schematic depicting the workflow of...

Ngày tải lên: 13/08/2014, 09:20

... Union of Biochemistry and Molecular Biology (IUBMB) & Federation of Asian and Oceanian Biochemists and Molecular Biologists (FAOBMB), Melbourne, Australia Best Poster Award, 2010, 3rd Department of ... Workflow and Single-plex assay performance 7.2.2 Discrimination of let-7 family homologs 7.2.3 Evaluation of multiplex assay performance and pre-amplification bias 7.2.4 Application of multiplex assays ... that GFRα2 isoforms mediated differential neuritogenic activities upon ligand stimulations (6) and suggested that ligand activation of GFRα 2a and GFRα2c may regulate distinct signaling pathways...

Ngày tải lên: 09/09/2015, 10:13

... pathway, the infra- and intrapyramidal MF (IIPMF) pathway The IIPMF pathway originates from hippocampal granule cells and terminates primarily upon the basal dendrites of superficial pyramidal ... due to increasing release of presynaptic glutamate, and requires the activation of PKA as well as the downstream targets of PKC and PKA Several substrates of PKA have been investigated for their ... distribution of IIPMFs is associated with superior spatial learning has been established Morris water maze and radial arm maze are among the popular behavioural training tasks to test the hippocampal-dependent...

Ngày tải lên: 09/09/2015, 18:55

... investigations on the different molecular mechanisms involved in amygdala-related cuedor tone-dependent fear conditioning xi List of Tables Table 4.1 Average concentrations and standard errors of ... reported data showing the Zn concentration in the three different strata (stratum lucidum SL, stratum pyramidale SO, and stratum oriens SP) of hippocampal CA3 region (Zhang et al., 2011) As the axon ... rostral dorsal hippocampus, MEMRI showed an increase in the high contrast area CA 3a area in trained Wistar rats Besides, the hypothesis that remodeling pattern of the MFs is strain-dependent has...

Ngày tải lên: 09/09/2015, 18:55

... high-performing energy management and environmental standards In addition, the approach was applied and validated through a case study Materials and methods A successful wastewater utility management system ... treatment are mechanical mixing, chemical dosing, media and membrane filtration, dissolved air floatation, sludge handling and disposal, and digester heating Wastewater treatment managers are attempting ... Multilinear regression analysis was employed to model and analyze the variables The analysis was conducted with energy as a dependent variable and BOD, suspended solids, average flow, and rainfall as...

Ngày tải lên: 05/09/2013, 15:28

... Transactions, vol 92, 1983, p 3.1086 [29] Arash Nemati, Shahram Khalilarya, Samad Jafarmadar, Hassan Khatamnejhad, Vahid Fathi Numerical parametric investigation of a gasoline fuelled partially-premixed ... for baseline and adiabatic with EGR cases are the same Also at adiabatic case for 400°CA and 420°CA, these regions more spread out in the main chamber and the values of local peak temperature ... study of three operating conditions of engine: base line, adiabatic and also adding EGR to the initial charge of adiabatic case at two load operating conditions: a full load and a part load (50%...

Ngày tải lên: 05/09/2013, 16:11

... Cummings et al., 1997); a Naval Oceanographic Office (NAVO) analysis (May et al., 1998); a NOAA Climate Analysis Center (CAC) objective analysis (Reynolds and Smith, 1994); and a NOAA National Environmental ... special competences and with regard for appropriate balance Support for this project was provided by National Aeronautics and Space Administration contract NASW-96013, and National Oceanic and Atmospheric ... reprocessing of the entire data set • The role of data analysis and reprocessing An active, continuous program of data analysis and reprocessing adds value to existing data sets and enables the...

Ngày tải lên: 17/02/2014, 07:20

... of pericytes and severe defects in the brain and heart, leading to vascular leakage and edema [55–57] Ligand–receptor signaling between two types of cells may mediate cellular communication and, ... toward an integrated theory that defines the entire cellular and molecular population, anatomically and functionally, as a single ‘unit’ In particular, the concept of a ‘neurovascular unit’ that ... pruning and specialization In brief, the nascent vasculatures formed by vasculogenesis and angiogenesis are stabilized via the recruitment of mural cells and generation of the extracellular matrix...

Ngày tải lên: 18/02/2014, 11:20

... radical anion abstracts a proton and generates a radical site that triggers dissociation to produce a complementary pair of fragment ions of type c¢ and z¢Æ Subtraction of the m ⁄ z values for ... and protein analysis, those that trap ions by radiofrequency electrostatic fields rather than with static magnetic and electric fields High-quality ECD spectra often require the averaging of data ... ETD-MS analysis of peptides and proteins charged) indicates that the Tyr residues at positions 31 and 40 are both 80 mass units higher in mass than expected and are therefore phosphorylated Analysis...

Ngày tải lên: 18/02/2014, 16:20

... complex-linking inflammation to cancer M Karin Department of Pharmacology, University of California, San Diego La Jolla, CA, USA E-mail: karinoffice@ucsd.edu A link between inflammation and cancer has been ... movement and adhesion Others act through regulating the activation state of Rho-family signalling pathways, for example by down-regulation of ROCK or Rho activation and up-regulating Rac activation ... loss -of- function mutants of FAK as skin-targeted transgenes, and have found that elevated FAK expression can cause accelerated carcinogenesis Abstracts and progression to carcinoma In addition to our...

Ngày tải lên: 19/02/2014, 07:20

... (SBTI), wheat a- amylase inhibitor (WAAI), bean a- amylase inhibitor (BAAI), maize a- amylase inhibitor (MAAI) and chickpea a- amylase inhibitor (CpAAI) on the midgut hydrolytic enzyme activities of two ... that may target EWS-FLI1 and RHA interaction OP-56 Role of p38 MAP kinases in oncogene-induced malignant transformation A Nebreda, I Dolado, A Cuadrado, V Lafarga and A Swat CNIO, Melchor Ferna´ndez ... concentration of ADP was calculated using the Keqapp value At balance of quasi-equilibrium concentrations of ADP and ATP/ADP ratio the mitochondrial respiration rate with mNDPK was 21% of the respiration...

Ngày tải lên: 19/02/2014, 07:20

... Bekmanov1, A Mansharipova2 and R Bersimbaev1 Molecular genetics, Institute of General Genetics and Cytology, Almaty, Kazakhstan, 2Institute of Cardiology and Internal Diseases, Almaty Kazakhstan E-mail: ... pathway ´ E Galeano, A I Garcı´ a- Perez and P Sancho Department of Biochemistry and Molecular Biology, University of ´, ´ Alcala Alcala de Henares, Spain E-mail: eva.galeano@uah.es Delocalized ... pneumoniae bacterial strain plays a critical role in fibrinolysis and degradation of extracellular matrix and appears one of important factors of the cell transmigration and host tissue colonization...

Ngày tải lên: 19/02/2014, 07:20

... federally-based standards: the National Ambient Air Quality Standards (NAAQS), National Emissions Standards for Hazardous Air Pollutants (NESHAP), and New Source Performance Standards (NSPS) In addition, ... oil and gas production, both on a national basis and for Region specifically Appendix C summarizes our assessment of available data sources, data limitations, and data gaps Using the best available ... state air permitting programs and BLM standards implemented in cooperation with EPA programs are also discussed National Ambient Air Quality Standards (NAAQS) Under the CAA, NAAQS establish health-based...

Ngày tải lên: 06/03/2014, 16:20

... transitions appear to differ between the aquatic unicellular green alga Chlamydomonas reinhardtii and land plants In particular, the greater extent of state transitions in Chlamydomonas compared with ... affecting the quantum yield of photosynthesis are low and high temperatures, CO2 availability, drought and mineral status (e.g Mg2+ and Fe2+ that act as cofactors of the components of the photosynthetic ... composed of 15 subunits The organization of the plant and green algal PSII core dimer and its associated antenna, the LHCII, has been revealed by cryo-electron microscopy and single particle analysis...

Ngày tải lên: 16/03/2014, 06:20