installing operating system on a macbook pro
Tài liệu Programming the Be Operating System-Chapter 1: BeOS Programming Overview ppt
Ngày tải lên :
26/01/2014, 07:20
... inheritance hierarchy of the Application
Kit. Creating an application object establishes the application’s main thread, which
serves as a connection between the application and the Application Server. ... a naming convention.
The BeOS software kits consist of classes (which contain member functions and
data members), constants, and global variables. The BeOS imposes a naming con-
vention on each ... other than RAM that is devoted to holding application code and data.
Typically, a system reserves hard drive space and uses that area as virtual mem-
ory. As a program executes, the processor...
- 30
- 460
- 0
Tài liệu Programming the Be Operating System-Chapter 2: BeIDE Projects docx
Ngày tải lên :
26/01/2014, 07:20
... forego a user interface and run in the background only. If
an application is marked as a background app, it behaves in this way and
won’t be named in the Deskbar.
Argv Only
An application can be ... original files from the project,
44 Chapter 2: BeIDE Projects
Application-information resource
There’s one other reason that a certain part of a program will exist as a resource—
a reason unrelated ... rename the project
file. Again, choose a name appropriate to the project. Typically, the project file has
the same name the application will have, with an extension of x86.proj or ppc.proj
added....
- 44
- 412
- 0
Chapter 1 Introduction to Routing and Packet ForwardingRouting Protocols and Concepts quangkien@gmail.com.Topicsl Inside the Router Ÿ Routers are computers Ÿ Router CPU and Memory Ÿ Internetwork Operating System Ÿ Router Bootup Process Ÿ Router Ports doc
Ngày tải lên :
09/03/2014, 13:20
... encapsulates the IP packet into
the proper data link frame, using the proper serial encapsulation (HDLC, PPP, etc.).
l The data link destination address is set to a broadcast (there’s only one other ... Path Determination and
Switching Functions
l Packet Fields and Frame Formats
l Best Path and Metrics
l Equal Cost Load Balancing
l Path Determination
l Switching Function
44
RTB
1. RTB examines ... Ports and Interfaces
Ÿ Routers and the Network
Layer
l Path Determination and
Switching Function
Ÿ Packet Fields and Frame
Formats
Ÿ Best Path and Metrics
Ÿ Equal Cost Load Balancing
Ÿ Path...
- 79
- 457
- 0
Báo cáo sinh học: " RNAi dependent epigenetic marks on a geminivirus promoter" pptx
Ngày tải lên :
19/06/2014, 08:20
... (30 s), and 72°C (5 min). The
PCR reactions were analysed by electrophoresis on a 2%
agarose gel. The primer pairs used were ACMV DNA A F:
CTCAACTAGAGACACTCTTGA and R: CACAAATATT-
TAATTGCCAG, Tnt-retroposon ... Tnt-retroposon (GenBank: X13777
) F:
CATTGGTTCTAAAGGATGTGCGGC and R: GAAATCT-
CATCTTGTGCCGCGTTC.
Results and conclusion
A transgene consisting of the promoter region of ACMV
DNA A was designed to produce ... northern
hybridization (AGGGGCCAACCGTATAATATTACCC)
corresponds to the Nona-nucleotide sequence within
ACMV DNA A. Total DNA was extracted from different
plant lines. 10 to 15 àg of DNA samples were...
- 4
- 262
- 0
báo cáo hóa học:" RNAi dependent epigenetic marks on a geminivirus promoter" doc
Ngày tải lên :
20/06/2014, 04:20
... amplifica-
tion the left arm (KpnI F: GGTACCAATCTCAACTAGA-
GACACTCTTGA) and (ClaI R:
ATCGATGCACAAATATTTAATTGCCAG), and the right
arm (XhoI F: CTCGACGCAGTTTATAAATTAACGGGTC)
and (BamHI R: GGATCCAATGAGTTGATCTCTGTGA-
GAACT). ... analysed by electrophoresis on a 2%
agarose gel. The primer pairs used were ACMV DNA A F:
CTCAACTAGAGACACTCTTGA and R: CACAAATATT-
TAATTGCCAG, Tnt-retroposon (GenBank: X13777
) F:
CATTGGTTCTAAAGGATGTGCGGC ... replication or
Small RNA-directed DNA and histone methylationFigure 2
Small RNA-directed DNA and histone methylation. (A) Schematic representation of Sau96 I restriction sites in ACMV
DNA A promoter...
- 4
- 244
- 0
Báo cáo hóa học: " On a-Šerstnev probabilistic normed spaces" potx
Ngày tải lên :
20/06/2014, 23:20
... space is a
TV space if, and only if, it is strict.
Lafuerza-Guillén and Shaabani Journal of Inequalities and Applications 2011, 2011:127
http://www.journalofinequalitiesandapplications.com/content/2011/1/127
Page ... a) is a PN space of Šerstnev
under any triangle function τ.
Lafuerza-Guillén and Shaabani Journal of Inequalities and Applications 2011, 2011:127
http://www.journalofinequalitiesandapplications.com/content/2011/1/127
Page ... 15
RESEARC H Open Access
On a- Šerstnev probabilistic normed spaces
Bernardo Lafuerza-Guillén
1
and Mahmood Haji Shaabani
2*
* Correspondence:
shaabani@sutech.ac.ir
2
Department of Mathematics,
College...
- 15
- 189
- 0
Tài liệu Using Samba-2. Installing Samba on a Unix System-P1 pptx
Ngày tải lên :
21/01/2014, 07:20
... Description
/usr/local/samba
Main tree
/usr/local/samba/bin
Binaries
/usr/local/samba/lib
smb.conf, lmhosts, configuration files, etc.
/usr/local/samba/man
Samba documentation
/usr/local/samba/private ... choose a site that is closest
to your own geographic location.
The standard Samba web sites have Samba documentation and tutorials,
mailing list archives, and the latest Samba news, as well as ... Let's start with the installation of Samba itself
on a Unix system. When dancing the samba, one learns by taking small
steps. It's just the same when installing Samba; we need to teach...
- 21
- 289
- 0
Tài liệu Using Samba-2. Installing Samba on a Unix System-P2 pdf
Ngày tải lên :
21/01/2014, 07:20
... location
of the main tree as samba_dir. In most configurations, this is the base
directory of the installed Samba package: /usr/local/samba .
WARNING: Watch out if you've made /usr a read-only ... you can start up Samba,
however, you need to create a configuration file for it.
2.4 A Basic Samba Configuration File
The key to configuring Samba is its lone configuration file: smb.conf. ... your system and will be ready to
accept connections.
2.5.2 Stand-alone Daemons
To run the Samba processes as stand-alone daemons, you need to add the
commands listed in the previous section...
- 21
- 311
- 0
Proposal for a COUNCIL DIRECTIVE on a common system of financial transaction tax and amending Directive 2008/7/EC pot
Ngày tải lên :
29/03/2014, 18:20
...
=1+ 1a
+3
N /A N /A N /A N /A N /A N /A N /A N /A
TOTAL
appropriations
for DG <…….>
Payments
=2+ 2a
+3
N /A N /A N /A N /A N /A N /A N /A N /A
Commitments (4)
N /A N /A N /A N /A N /A N /A N /A N /A
y ... shall also make use of already existing
reporting and data maintenance obligations related to financial transactions.
Chapter IV
Final provisions
Article 12
Other taxes on financial transactions ... Directive shall apply to all financial transactions, on condition that at least one party
to the transaction is established in a Member State and that a financial institution
established in...
- 31
- 569
- 0
báo cáo hóa học:" Research Article Note on the Persistent Property of a Discrete Lotka-Volterra Competitive System with Delays and Feedback Controls" pptx
Ngày tải lên :
21/06/2014, 11:20
... conditions on the coefficients are given to guarantee
that all the species are permanent. It is shown that these conditions are weaker than those of Liao
et al. 2008.
1. Introduction
Traditional ... exponentially for 2 ≤ i ≤ N, and u
i
t → X
∗
, where X
∗
is a certain solution of
a logistic equation. Teng 8 and Ahmad and Stamova 9 also studied the coexistence on a
nonautonomous Lotka-Volterra ... 2, } and 0 < ;a
l
≤ a
u
,0<b
l
≤ b
u
. Similarly to the proof of Propositions 1 and 3 in 12,
we can obtain the following.
Hindawi Publishing Corporation
Advances in Difference Equations
Volume...
- 9
- 351
- 0