... purpurea) NP_053827, Athal2 (Arabidopsis thaliana IscA2) AC005825.3, Athal3 (Arabidopsis thaliana IscA3), AC006921.5, A_ vinIscA (Azotobacter vinelandii IscA) T44283, A_ vinOrf6 (Azotobacter vinelandii ... GATAATCTGAAAACC-3¢, MOslr1417-4 5¢-GGAT TTACCACAACCAgctGTTTGATTAGCATT-3¢ and MOslr1417-5 5¢-CCAAAGGATTTACCggcgCCACAGG TTTG-3¢ (lower case type indicates the introduced mutations, new cleavage sites ... (5¢-GATCTAAGCTTAAA CCCCAAAGGATTTACC-3¢) The resulting 376-bp fragment was cleaved with NdeI and HindIII and cloned into the expression plasmid pRSET 5a [23] cleaved with the same enzymes creating the...
Ngày tải lên: 31/03/2014, 01:20
... number of animals included (2 animals were infected with the early-stage variant, two with the intermediate-stage variant, and four with the late-stage variants) However, despite the small sample ... that animals infected with the late-stage variants did eventually develop NtAb, and in some cases, at titers comparable to those of SIVMneCL8-infected animals There was some variation in the magnitude ... infected with the early variant, 1.39% in animals infected with the intermediate variant, and 1.69% in animals infected with the late variants We also calculated the divergence of each SIV sequence...
Ngày tải lên: 20/06/2014, 01:20
Báo cáo hóa học: " Research Article Implementation and Validation of a New Combined Model for Outdoor to Indoor Radio Coverage Predictions" pptx
... Tracing and Ray Launching where: (i) ray Launching emits the rays from the transmitter Signal strength degenerates as the rays propagate and additional loss is added when rays reflect or diffract ... maps for extracting the shapes of the buildings, and a laser meter to measure the height of each building Hence it is not a real full 3D database but a 2.5D database, in a dat format similar to ... provides a high accuracy However, a disadvantage is that the size of the pixels of the spatial grid has to be very small compared to the wavelength of the signal, leading to a high complexity for large...
Ngày tải lên: 21/06/2014, 11:20
capital structure and firm performance a new approach to testing agency theory and an application to the banking industry
... physical capital, financial equity capital); and an environmental variable STNPL (the ratio of total nonperforming loans to total loans in the bank’s state) to control for the business conditions ... profits The prices are calculated as exogenous market averages that a bank faces in its local market(s).9 These prices incorporate supply and demand conditions for assets and liabilities in the markets ... these additional banks are owner managed rather than professionally managed, and therefore not provide a good laboratory for testing the agency costs of the separation of ownership and management.19...
Ngày tải lên: 13/07/2014, 21:13
Tài liệu The King''''s Post Being a volume of historical facts relating to the Posts, Mail Coaches, Coach Roads, and Railway Mail Services of and connected with the Ancient City of Bristol from 1580 to the present time pdf
... and manager of the Bath and Bristol theatres, and went about beating up actors, actresses, and companies in postchaises, and he thought letters should be carried at the same pace at which it was ... FREELING, MAIL AND COACH ADMINISTRATORS On the 25th April, 1901, the day after a visit to Bristol to celebrate the establishment of the new steamship line to Jamaica, the Marquess of Londonderry, then ... commands to carry the plan into execution to the other parts of the kingdom To this (and I have not the least fear of accomplishing it) will be the most decisive answer to abuse, and more satisfactory...
Ngày tải lên: 17/02/2014, 02:20
Tài liệu Báo cáo khoa học: "A New Dataset and Method for Automatically Grading ESOL Texts" pdf
... iii and iv are scaled so that their final value has approximately the same order of magnitude as i and ii The script length is based on the number of words and is mainly added to balance the effect ... meta-data about the question prompts, the candidate’s grades, native language and age The FCE writing component consists of two tasks asking learners to write either a letter, a report, an article, ... its correlation with the four senior examiners in addition to the RASCH-adjusted CLC scores Tables and present the results obtained The average correlation of the AA system with the CLC and the...
Ngày tải lên: 20/02/2014, 04:20
WHY IT IS SO HARD TO GET SAFE WATER TO THE POOR – AND SO PROFITABLE TO SELL IT TO THE RICH pdf
... Esray et al 12 concluded that availability of water was more important than the quality of the water People with piped water in Kenya, Tanzania and Uganda used on average 16 litres a day for washing ... holistic pattern Hand washing and sanitation are major factors, and The quality and irregularity of water supply is disas- 1.3.2 SAFE WATER IS A COMPLEX ISSUE trous for the poor : even in many cities ... drinking water : It is a simple water treatment method using solar UV -A radiation and temperature to inactivate pathogens that cause diarrhoea It is also crucial to understand the social process and...
Ngày tải lên: 07/03/2014, 00:20
Báo cáo khoa học: Expression and characterization of the protein Rv1399c from Mycobacterium tuberculosis A novel carboxyl esterase structurally related to the HSL family docx
... of parallel b strands associated to an antiparallel strand (b2) and is surrounded by helices (a1 , a2 , a3 , a7 and a8 ) The second domain consists of helices a4 , a5 and a6 all clustered on the top ... hydrolases (Fig 3) These enzymes share a functional catalytic triad made of a catalytic nucleophile serine, associated to a proton carrier histidine and a charge relaying aspartic (or glutamic) acid ... connecting helix a8 to strand b8, a five-residues loop connecting strand b3 to helix a1 and two small helices (a4 and a6 ) The catalytic site consists of a functional catalytic triad found in all serine...
Ngày tải lên: 07/03/2014, 16:20
Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot
... CLAP_1:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT CLAP_2:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT ... CLAP_2:ATTAGTGCTATAGTTTGGGAAATATTTAGTCCTTGTTTTGTGTGATCTTATAAGATAATATTTGTAGTTTGTGCTTTTATATAATTTAGCTCATTGGATT 1730 * 1888 CLAP_1:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA CLAP_2:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA (A) 48 ... CLAP_1:GACATGAAACTGAGAACTCTCCTCACAAAGAGGGACTTGAGGATTAATTTGTATGACAATGGGCAGACAATTCTTGCCGGTGGGAAACGTATAAATGGAT CLAP_2:GACATGAAACTGAGAACTCTCCTCACAAAGAGGGACTTGAGGATTAATTTGTATGACAATGGGCAGACAATTCTTGCCGGTGGGAAACGTATAAATGGAT D...
Ngày tải lên: 07/03/2014, 16:20
Báo cáo khóa học: S-(2,3-Dichlorotriazinyl)glutathione A new affinity label for probing the structure and function of glutathione transferases potx
... particular, the mean B-factors of Met121 at ˚ ˚ the A and B chains are 26.67 A2 and 49.26 A2 , and the ˚ and 79.30 A2 , respect˚ B-factors of S atoms are 38.14 A ively It is therefore reasonable to ... (data not shown) indicates the absence of any structural perturbation caused by the mutation Aminoacid analysis of the SDTG-modified Phe51Ala mutant and determination of its total amino and carboxy ... Met121Ala mutation, 5¢-ATCAGTCCGGCACTTGGGGGAACC-3¢ and 5¢-GAGGACGTCGAAGAGGATGGGTTACAG-3¢ The mutation (codon underlined above) was confirmed by DNA sequencing on Applied Biosystems Sequencer 37 3A with...
Ngày tải lên: 16/03/2014, 16:20
Báo cáo khoa học: Viral entry mechanisms: human papillomavirus and a long journey from extracellular matrix to the nucleus docx
... and acetylated to various degrees O-sulfation occurs at the 2-O, 3-O, and 6-O position of the uronic acid and at the 3-O and 6-O position of the amino sugar The amino group of the glucosamine may ... at a conserved cleavage site Host cell CyPB facilitates the L2 conformation changes (3) These events may induce an additional conformational change that either reduces the affinity of capsids to ... endocytosed via a clathrin- and caveolinindependent pathway, whereas BPV1 and HPV31 were shown to enter via clathrincoated pits and caveolae, respectively Additional details are provided in the...
Ngày tải lên: 23/03/2014, 04:20
Báo cáo khoa học: Cytochrome P460 of Nitrosomonas europaea Formation of the heme-lysine cross-link in a heterologous host and mutagenic conversion to a non-cross-linked cytochrome c ¢ pot
... 5¢-AAATGCTTCAATGATAT CGAAAAAGGAAG-3¢, converted a unique SspI site on the vector to an EcoRV site The mutagenesis oligonucleotides were 5¢-GTAACTGTAAGAGAACTGGTCAC-3¢ (Lys70 to Arg), 5¢-GTAACTGTAGCAGAACTGGTCA ... and a small maximum at 688 nm On reduction, the Soret shifts to 460 nm and the 500 and 688 nm peaks disappear but a and b maxima typical of c-type cytochromes not appear The addition of CO causes ... sulfate was then added to the periplasmic extract to 75% saturation and stirred for 45 at °C before centrifugation at 15 000 g for 15 at °C The pellet was discarded, and the supernatant brought to...
Ngày tải lên: 23/03/2014, 17:21
new financial and statistical measures to monitor the success of ge
... these two characteristics of buying a bond and compare them with the profits from buying shares of stock that have the same value as one bond I will name the new measure: Stockholders Comparable ... would have to examine the financial position of the company and we would assign a value to the risk of buying the shares Then we would multiply that value with the SCU ratio However, in the case ... now With the new ratio that I am going to introduce I am making an attempt to help eliminating any kind of mistrust to the company due to reasons which are not related to the financial statements...
Ngày tải lên: 23/03/2014, 20:44
Stress and Performance - A Review of the Literature and Its Applicability to the Military pdf
... review to ensure that they meet high standards for research quality and objectivity Stress and Performance A Review of the Literature and Its Applicability to the Military Jennifer Kavanagh Approved ... X and Y (and X and Y are correlated), then X will be correlated with A and will have an effect on Y independent of X A moderator variable is one that affects (usually reduces) the causal relationship ... forms, ranging from personality type to specifically targeted forms of training, and are It is important to distinguish a moderator from a mediator variable A mediator variable is one that...
Ngày tải lên: 29/03/2014, 18:20
Báo cáo sinh học: " Medical education and research environment in Qatar: a new epoch for translational research in the Middle East" pptx
... Palestine-Egypt, Palestine-Lebanon, Russia, Saudi Arabia, Sri Lanka (2 each); Algeria, Bosnia, Germany, Kenya, Kuwait, Mauritania, Mauritius, Nepal, Philippines, Tanzania, Tunisia, U .A. E., United ... innovative and visionary set of initiatives to create lasting benefits for the country of Qatar and to increase the visibility of Qatar within the global community A crucial component of these initiatives ... opportunities available to the students and faculty at WCMC- Q An example of such opportunities is the availability of research funds through the Qatar Foundation’s Qatar National Priority Research...
Ngày tải lên: 18/06/2014, 19:20
báo cáo hóa học: " Virtual reality and physical rehabilitation: a new toy or a new research and rehabilitation tool?" pptx
... rehabilitation Assist Technol 2004, 16:54-62 Sherman W, Craig A: Understanding virtual reality: Interface, application, and design California: Morgan Kaufmann; 2002 Stanney KM: Handbook of Virtual ... Rizzo AA, Kim G: A SWOT analysis of the field of virtual rehabilitation and therapy Presence: Teleoperators and Virtual Environments in press Rizzo AA, Schultheis MT, Kerns K, Mateer C: Analysis ... considered virtual reality? Factors that differ among many of the laboratories claiming to use virtual reality and that also emerge amongst this group of papers include field of view, the presence...
Ngày tải lên: 19/06/2014, 10:20
báo cáo hóa học:" Medical education and research environment in Qatar: a new epoch for translational research in the Middle East" doc
... Palestine-Egypt, Palestine-Lebanon, Russia, Saudi Arabia, Sri Lanka (2 each); Algeria, Bosnia, Germany, Kenya, Kuwait, Mauritania, Mauritius, Nepal, Philippines, Tanzania, Tunisia, U .A. E., United ... innovative and visionary set of initiatives to create lasting benefits for the country of Qatar and to increase the visibility of Qatar within the global community A crucial component of these initiatives ... opportunities available to the students and faculty at WCMC- Q An example of such opportunities is the availability of research funds through the Qatar Foundation’s Qatar National Priority Research...
Ngày tải lên: 20/06/2014, 03:20
Change One Thing Discover What''''s Holding You Back and Fix It With the Secrets of a Top Executive Image Consultant_1 docx
... shrewd and tight when it comes to money They are steady Freddies who are dependable and not the least bit impulsive YY Gray Those whose favorite color is gray are cautious and seek calm and peace They ... polyester and wool fabric that won’t wrinkle in a folded gar- The Clothes Make the Manager 41 ment bag If you want to make it a bit more interesting, you can buy a suit that has a weave or a minimal ... come up with something they dislike about their appearance As the well-known affirmation says, you should change what you can and accept what you can’t change— and try to make the best of it Believe...
Ngày tải lên: 21/06/2014, 03:20
Change One Thing Discover What''''s Holding You Back and Fix It With the Secrets of a Top Executive Image Consultant_2 pptx
... because I was unable to forgive what I saw as his betrayal This man later became the CEO of a major corporation that I wanted to have as a client What I should have done, had I been a more mature ... subject to derogatory remarks Only three cities—Washington, D.C., San Francisco, and Santa Cruz (California)—have laws against discriminating on the basis of weight, so there isn’t much you can legally ... glasses that are too thick You get the picture, and it s not a pretty one One day when I was out to lunch with friends, I noticed a young Asian woman sitting at another table The reason she stood...
Ngày tải lên: 21/06/2014, 03:20
Change One Thing Discover What''''s Holding You Back and Fix It With the Secrets of a Top Executive Image Consultant_4 doc
... and use it Europeans also eat salads and cheese after their entrée European portions tend to be smaller than Americans are used to, so don’t complain to the waiter at a French restaurant that you ... people are forced to ask you to repeat what you’ve just said, which is tiresome Practice reading a paragraph with a pencil in your mouth Then take the pencil out, and read the paragraph again I ... place.” My preference is to take a deep breath and start again to avoid a break in the momentum 5. Someone has had too much to drink and starts heckling or being rude while you’re making a toast...
Ngày tải lên: 21/06/2014, 03:20