... carcinoma Clin Cancer Res 20 07, 13 ( 23 ):69 93- 70 02 Takao M, Okamoto A, Nikaido T, Urashima M, Takakura S, Saito M, Saito M, Okamoto S, Takikawa O, Sasaki H, Yasuda M, Ochiai K, Tanaka T: Increased synthesis ... J Cancer Res Clin Oncol 20 08, 134 : 525 - 533 Miyazaki T, Moritake K, Yamada K, Hara N, Osago H, Shibata T, Akiyama Y, Tsuchiya M: Indoleamine 2, 3- dioxygenase as a new target for malignant glioma ... 825 3 .21 2 598 - .24 1 1. 32 1 38 9 25 8 579 638 37 8 524 091 10 .22 0 30 . 821 878 405 6 .3 62 1 1 1 7 63 001 000 34 9 525 0 12 889 2. 281 24 . 830 1.818 786 3. 746 upper 415 1 .37 6 7.989 521 37 5 1 .3 42 1.906 3. 783...
Ngày tải lên: 18/06/2014, 15:20
... CII and CFA and treated with 1-MT or vehicle Sera were obtained on days 5, 22 , 33 , and 54 Values are presented as the mean and standard error of the mean of 25 1-MT-treated and 20 vehicle-treated ... 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 Munn DH, Mellor AL: Indoleamine 2, 3- dioxygenase and tumorinduced tolerance J Clin Invest 20 07, 117:1147-1154 Yuan W, Collado-Hidalgo A, Yufit T, Taylor ... 2, 3- dioxygenase, and tryptophan catabolism FASEB J 1991, 5 :25 16 -25 22 Varga J, Yufit T, Brown RR: Inhibition of collagenase and stromelysin gene expression by interferon-gamma in human dermal fibroblasts...
Ngày tải lên: 09/08/2014, 10:20
Báo cáo y học: "Indoleamine 2,3-dioxygenase-expressing dendritic cells are involved in the generation of CD4+CD25+ regulatory T cells in Peyer''''s patches in an orally tolerized, collagen-induced arthritis mouse model" ppt
... CD8α+ DC, with a plasmacytoid phenotype, induce differentiation and Page 10 of 10 (page number not for citation purposes) 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 support function ... IDO sense (5'-CACTGTACCAGTGCAGTAG -3' ) and antisense (5'-ACCATTCACACACT CGTTAT -3' ) primers, and using Foxp3 sense (5'-CAGCTGCCTACAGTGCCCCTAG -3' ) and antisense (5'CATTTGCCACGAGTGGGTAG -3' ) primers ... regulatory T cells Nat Immunol 20 03, 4: 120 6- 121 2 Yoshida R, Nukiwa T, Watanabe Y, Fujiwara M, Hirata F, Hayaishi O: Regulation of indoleamine 2, 3- dioxygenase activity in the small intestine and the epididymis...
Ngày tải lên: 09/08/2014, 10:22
báo cáo khoa học: "Upregulated expression of indoleamine 2, 3-dioxygenase in CHO cells induces apoptosis of competent T cells and increases proportion of Treg cells" pptx
... 5’-CATCTGCAAATCGTGACTAAG -3 ; antisense 5’-CAGTCGACACATTAACCTTCCTTC -3 b-actin (186 bp) was used as an internal control; sense 5’-TGGCACCCAGCACAATGAA -3 ; antisense 5’-CTAAGTCATAGTCCGCCTAGAAGCA -3 ... 5’-CCCACTTACAGGCACTCCTC -3 ; antisense 5’-CTTCTCCTTCTCCAGCACCA -3 ; b-actin, sense 5’-TGGCACCCAGCACAATGAA -3 ; antisense 5’CTAAGTCATAGTCCGCCTAGAAGCA -3 PCR amplifications were performed in a 20 μl volume with each reaction ... resistance mechanism based on tryptophan degradation by indoleamine 2, 3- dioxygenase Nat Med 20 03, 9: 126 9-74 Mellor AL, Keskin DB, Johnson T, et al: Cells expressing indoleamine 2, 3dioxygenase inhibit...
Ngày tải lên: 10/08/2014, 10:21
Tài liệu Báo cáo Y học: A novel meta-cleavage dioxygenase that cleaves a carboxyl-groupsubstituted 2-aminophenol Purification and characterization of 4-amino-3-hydroxybenzoate 2,3-dioxygenase from Bordetella sp. strain 10d doc
... molecular mass However, the molecular mass of 4-amino -3- hydroxybenzoate 2, 3- dioxygenase is smaller than that of well-known extradiol dioxygenases, such as catechol 2, 3- dioxygenase [2] , protocatechuate ... in basal medium containing only yeast extract (0. 025 gÆL)1) as a control Each culture was incubated in a 500-mL flask at 30 °C with shaking Disappearance of 4-amino -3- hydroxybenzoic acid (m) was ... protocatechuate 2, 3- dioxygenase [31 ], protocatechuate 4,5 -dioxygenase [ 32 ] and 2- aminophenol 1,6 -dioxygenase The enzyme is a homodimer, whereas other known dioxygenases are homotetramers [2, 31 ] or heterotetramers...
Ngày tải lên: 21/02/2014, 01:21
Tài liệu Module 2: TCP/IP as a Solution for Networking pdf
... information or explanation on optimizing IP performance IP Stack IP Stack Delay and Latency IP MTU Data Data Data Data IP TCP Data Link Link Link IP TCP Data Link Header Trailer Trailer Header ... used, you can specify IP addresses based on: Classes (A, B, C) with an associated default mask Classes with variable length subnet masks (VLSM) Classless Inter-Domain Routing (CIDR) with a specified ... private IP network addresses is appropriate for the design? a 10.0.0.0 b 23 0. 120 .0.0 c 169 .25 4.0.0 d 1 92. 168.0.0–1 92. 168 .25 5.0 Answers a and d Answers b and c are not appropriate because 23 0.x.x.x...
Ngày tải lên: 21/12/2013, 05:18
Tài liệu Module 3: DHCP as a Solution for IP Configuration pptx
... 23 9 .25 5.0.0 to 23 9 .25 5 .25 5 .25 5 23 9 .25 4.0.0 to 23 9 .25 4 .25 5 .25 5 23 9 .25 3. 0.0 to 23 9 .25 3 .25 5 .25 5 Note For more information on MADCAP and support for multicast groups, see the IETF draft: "Multicast ... network traffic and IP address release As lease length Network traffic IP addresses release Increases decreases later Decreases increases sooner Note To immediately reclaim DHCP resources, you can configure ... 951, 21 31 , and 21 32 , and the Internet Engineering Task Force (IETF) draft “Multicast Address Dynamic Client Allocation Protocol (MADCAP)”, dated May 24 , 1999, or the latest revision, which is available...
Ngày tải lên: 17/01/2014, 08:20
Tài liệu Báo cáo Y học: EPR characterization of the mononuclear Cu-containing Aspergillus japonicus quercetin 2,3-dioxygenase reveals dramatic changes upon anaerobic binding of substrates potx
... none 2. 33 7; 11.0 5,7; 4¢ 2. 33 6; 11.0 5,7; 3 ,4¢,5¢ 2. 33 1; 11.5 5,7; 2 ,4¢ 2. 32 0 ; 14.1 5,7; 2 2. 31 5; 14.0 7; 3 ,4¢ 2. 31 0; 14.0 7; none 2. 31 1; 14.1 none; none Chemical structure 2. 31 0; 14 .2 OH ... awamori was cotransformed with a 5.7-kb SalI fragment from pUR7857 (containing an exact fusion between 2, 3QD and the Aspergillus awamori endoxylanase promoter and transcription terminator) and a 2. 4-kb ... EDTAÆ2H2O, 0.11 g CaCl2Æ2H2O, 75 mg FeSO4Æ7H2O, 28 mg MnSO4ÆH2O, 27 mg ZnSO4Æ7H2O, mg CuSO4Æ 5H2O, mg CoCl2Æ6H2O, mg Na2MoO4Æ2H2O, mg H3BO3, mg KI, pH 4.0 with NaOH), 0.1–0.5% yeast extract and...
Ngày tải lên: 22/02/2014, 07:20
Báo cáo khóa học: S-(2,3-Dichlorotriazinyl)glutathione A new affinity label for probing the structure and function of glutathione transferases potx
... were as follows: Phe51Ala mutation, 5¢-CGGAACCCCGCAGGTCGAGTTTCC -3 and 5¢-GA CGAGGTGCTCGGGGCTCTT -3 ; Met 121 Ala mutation, 5¢-ATCAGTCCGGCACTTGGGGGAACC -3 and 5¢-GAGGACGTCGAAGAGGATGGGTTACAG -3 The ... (20 02) Structure of a tau class glutathione 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 S-transferase from wheat active in herbicide detoxification Biochemistry 41, 7008–70 020 Labrou, N.E., Rigden, ... a- helix H¢¢ 3 (residues 188– 122 ) A large difference is centred on Met 121 In particular, the mean B-factors of Met 121 at ˚ ˚ the A and B chains are 26 .67 A2 and 49 .26 A2 , and the ˚ and 79 .30 A2 , respect˚...
Ngày tải lên: 16/03/2014, 16:20
Báo cáo khoa học: The role of residue Thr249 in modulating the catalytic efficiency and substrate specificity of catechol-2,3-dioxygenase from Pseudomonas stutzeri OX1 ppt
... 3, 5-DMC, as depicted in Fig 2D,E FEBS Journal 27 3 (20 06) 29 63 29 76 ª 20 06 The Authors Journal compilation ª 20 06 FEBS L Siani et al Thr249 in catechol -2, 3- dioxygenase function C2,3O, and T249G C2,3O, ... 20 06 FEBS 29 71 Thr249 in catechol -2, 3- dioxygenase function L Siani et al Bacterial strains and plasmids Escherichia coli strain BL21(DE3) and plasmid pET22b(+) were purchased from Novagen (Madison, ... catecholic dioxygenase: the crystal structure of catechol 2, 3- dioxygenase (metapyrocatechase) from Ppseudomonas putida mt -2 Structure Fold Des 7, 25 34 Sato N, Uragami Y, Nishizaki T, Takahashi...
Ngày tải lên: 30/03/2014, 10:20
Báo cáo khoa học: "Mutation and overexpression of p53 as a prognostic factor in canine mammary tumors" pptx
... methodological study using four anti-human p 53 antibodies Histol Histopathol 20 01, 16, 1 13- 121 Benjamin SA, Lee AC, Saunders WJ Classification and behavior of canine mammary epitherial neoplasms based ... CDM p 53 protein expression in ductal carcinoma in situ (DCIS) of the breast Breast Cancer Res Treat 1997, 42, 28 3 -29 0 p 53 as a prognostic factor in cmt 23 Rohan TE, Hartwick W, Miller AB, Kandel ... canine p 53 protein towards CM-1 (rabbit anti-human p 53 polyclonal antibody), PAb240 (mouse anti-human p 53 monoclonal antibody), BP 53- 12 and PAb 122 (mouse anti-human p 53 monoclonal antibody), which...
Ngày tải lên: 07/08/2014, 17:22
Báo cáo y học: " Percentile benchmarks in patients with rheumatoid arthritis: Health Assessment Questionnaire as a quality indicator" pot
... 1.875 2. 125 2. 25 2. 37 5 2. 37 5 2. 5 2. 37 5 2. 625 95 2. 125 2. 25 2. 37 5 2. 5 2. 5 2. 625 2. 625 2. 625 2. 875 10 0. 125 0. 125 0. 125 0. 125 0 .25 0 .37 5 0 .37 5 0 .37 5 0. 625 25 0.5 0.5 0.5 0. 625 0.875 1 1. 125 1 .25 50 ... 1. 125 1. 125 1 .25 1.5 1. 625 1.75 1.75 1.875 75 1. 625 1. 625 1.75 1.875 2. 125 2. 25 2. 37 5 2. 37 5 90 2. 125 2. 125 2. 37 5 2. 37 5 2. 37 5 2. 5 2. 625 2. 75 2. 75 95 ≥ 70 10 25 2. 37 5 2. 5 2. 625 2. 625 2. 625 2. 75 2. 75 ... 1 .37 5 1.5 1. 625 1. 625 1. 625 1.75 1.875 90 1.875 1.875 2 2. 125 2. 125 2. 25 2. 125 2. 125 2. 25 2. 25 2. 25 2. 37 5 2. 37 5 2. 5 10 0 0. 125 0 .25 0. 125 0. 125 0 0. 125 0 .37 5 0 .37 5 0. 625 0. 625 0. 625 0.5 0.5 0.5...
Ngày tải lên: 09/08/2014, 01:24
báo cáo khoa học: "A Study to investigate the role of p27 and Cyclin E immunoexpression as a prognostic factor in early breast carcinoma" pptx
... node metastases is: Low :2, negative:7 Statistical analysis The average age of patients with distant metastases (44 years) was 10 years younger than patients without distant metastases (54 years) ... spread and vascular invasion with distant metastases free survival (MFS) in all invasive carcinomas and the subgroup of IDC in an univariate analysis However, there was no significant association ... group, cyclin E was statistically associated with distant metastases (p = 0.05) whereas p27 was still not associated with distant metastases (p = 0.41) 88% (29 /33 ) of patients with negative cyclin...
Ngày tải lên: 09/08/2014, 01:24
Báo cáo khoa học: "Mid-regional pro-adrenomedullin as a prognostic marker in sepsis: an observational study" pot
... manner as a batch analysis MR-proADM was detected in EDTA plasma of all patients using a new sandwich immunoassay (B.R .A. H.M.S Sevadil® LIA; B.R .A. H.M.S., AG, Hennigsdorf/Berlin, Germany), [ 23 ] ... Biol Chem 20 01, 27 6: 122 92- 1 23 00 Marutsuka K, Nawa Y, Asada Y, Hara S, Kitamura K, Eto T, Sumiyoshi A: Adrenomedullin and proadrenomudullin N-terminal 20 peptide (PAMP) are present in human colonic ... had no impact on recovery of the analyte Stability of the analyte (
Ngày tải lên: 12/08/2014, 23:20
Báo cáo y học: "Value and price of ventilator-associated pneumonia surveillance as a quality indicator" potx
... Intensive Care Med 20 04, 30 :996-997 doi:10.1186/cc8189 Cite this article as: Aardema LM, et al.: Value and price of ventilator-associated pneumonia surveillance as a quality indicator Critical Care 20 10, ... in the acute care setting Am J Infect Control 20 08, 36 :30 9 -3 32 Tulleken JE, Zijlstra JG, Ligtenberg JJ, Spanjersberg R, Van der Werf TS: Ventilator-associated pneumonia: caveats for benchmarking ... References Klompas M: Unintended consequences in the drive for zero Thorax 20 09, 64:4 63- 465 Klompas M: The paradox of ventilator-associated pneumonia prevention measures Crit Care 20 09, 13: 315 Curtis...
Ngày tải lên: 13/08/2014, 20:21
synthesis and evaluation of 2,3-dihydroquinazolinones as dual inhibitors of angiogenesis and cancer cell proliferation
... B-Ring Analogs 35 2. 1 Synthesis of A- Ring Analogs 37 2. 2 Synthesis of B-Ring Analogs 40 2. 3 Biological Evaluation & SAR Conclusions 42 2.4 Chapter References 48 C-Ring Analogs and D-Ring Analogs 52 ... Quinazolinones 19 and 20 41 2. 2C: Synthesis of Quinoxaline 21 42 3. 1A: Synthesis of C-Ring Analogs 22 – 29 54 3. 1B: Synthesis of C-Ring Analog 30 54 3. 1C: Synthesis of C-Ring Analog 31 55 3. 2A: ... 2. 3A: Microtubule Depolymerization and Tritiated Colchicine Displacement for A- and B- Ring Analogs 43 2. 3B: HCC -29 98 Antiproliferative Activities of Analogs – 21 45 2. 3C: HMVEC Antiproliferative...
Ngày tải lên: 13/11/2014, 11:20
Climate change as environmental and economic hazard - phần 2.3
... insurance in rural Bangladesh? Mitigation and Adaptation Strategies for Global Change, 14 (3) 21 5 – 22 9 Albala-Bertrand, J M., 20 06 The Unlikeliness of an Economic Catastrophe: Localization and ... Finucane, M L., Peters, E and MacGregor, D G., 20 04 Risk as analysis and risk as feelings: some thoughts about affect, reason, risk, and rationality Risk Analysis, 24 (2) 31 1– 32 2 Stern, N., 20 07 ... Oliveira, 20 08); pandemics (Buus and Olsson, 20 06; Shih et al., 20 08; Ungar, 20 08) and climate change (McComas and Shanahan, 1999; Weingart et al., 20 00; Berglez, 20 08; Olsson and Paglia, 20 08) This article...
Ngày tải lên: 07/10/2012, 15:57
Unit 12 A1, 2, 3: Let’s sing a song
... sing a song REVISION • Choose the correct answers and fill in the blank : Do you play soccer ? a Do/ plays b Does/ play c Do/ play Yes I play soccer a don’t play b play c plays ... Does he play volleyball? a Does/ plays b Does/ play c Do/ plays No He doesn’t play .volleyball a plays b don’t play c doesn’t play .Does Lan go to school? a Does/ goes ... No She doesn’t .go to school a doesn’t go b don’t go c does go Let’s sing : “What are you doing?” Tuesday, February 26 th, 20 08 soccer Sports badminton Pastimes ...
Ngày tải lên: 23/06/2013, 01:26
Unit 4 leson 2 a 2-3 read
... There are 20 classrooms h There are 900 students Answer the questions Where’s Phong’s school? Where’s Thu’s school? How many classrooms are there in Phong’s school? How many classrooms are there ... lesson A3 -5 P45 - 46 Let’s predict Phong’s school a b c d e f g h Thu’s school It’s small It’s big It’s in the city It’s in the country There are classrooms There are 20 classrooms There are 400 ... is big There are twenty classrooms There are nine hundred student in the school Correct answers Phong’s school a It’s small d It’s in the country e There are classrooms g There are 400 students...
Ngày tải lên: 30/06/2013, 01:28
E 7 Unit3 A 2,3
... TALKING A; WHAT AN AWFUL DAY! IT'S VERY COLD B:COME AND SIT HERE, PLEASE! A: WHAT A LOVELY ROOM! A; WHAT AN AWFUL DAY! IT'S VERY COLD B:COME AND SIT HERE, PLEASE! A: WHAT A LOVELY ROOM! 2/ CONCEPT ... MÁY R A CHÉN DISHWASHER BỒN TẮM TUB BỒN R A CHÉN SINK MÁY SẤY DRYER MÁY GIẶT WASHING MACHINE SHOWER VÒI HOA SEN 1/NEW WORDS : AWFUL (ADJ) KINH KHỦNG DELICIOUS (ADJ) NGON DELIGHTFUL (ADJ) THÚ ... Awful/ Day GUESSING GAME: IS THERE+ A/ AN+N? ARE THERE ANY+ N(S/ES)? IV/ HOMEWORK: Make sentences with " What+ a/ an+ adj+N! A. The film is very interesting B.This shower is very awful C.The tub is...
Ngày tải lên: 02/08/2013, 01:27