in dna we trust
The CFO future series in digital we trust using technology to rebuild consumer confidence in financial services
Ngày tải lên :
04/12/2015, 00:22
... Do the costs for this investment look proportionate? Is the approach to investment right? Are we prioritising our capital in the right way? Are we investing in the right things to maximise customer ... role, Ms Bousfield says In short, the technology investment “has fundamentally changed our business model in terms of the level of staff we need and the kind of interactions we can have with customers” ... stored inside people’s heads, and each year there were fewer of those people around “Every time we wanted to launch a new product or go into a new market segment we were effectively starting from...
- 3
- 205
- 0
Tài liệu Báo cáo khoa học: Roles of the human Rad51 L1 and L2 loops in DNA binding doc
Ngày tải lên :
19/02/2014, 06:20
... residues are involved in the ssDNA binding by bacterial single stranded DNA- binding protein (SSB) and human replication protein A (RPA) [23,24], we performed mutational analyses on Tyr232 in the L1 ... alanine If the aromatic side chain is involved in the interaction with DNA, then its replacement with alanine, a short side chain amino acid residue, should affect the DNA binding of the protein ... residue in the L1 loop is involved in the functional DNA binding during strand exchange Tryptophan-scanning mutagenesis of the HsRad51-L1 loop To gain further information about DNA binding by...
- 12
- 662
- 0
Báo cáo khoa học: Roles of base excision repair subpathways in correcting oxidized abasic sites in DNA pptx
Ngày tải lên :
16/03/2014, 13:20
... decreased in reactions including FEN-1 and dNTPs (Fig 4A) Repair DNA synthesis, displacing the 5¢-dLp residue by Polb alone, did not block the DPC formation, indicating that removal of dL-containing DNA ... 5¢-dRp, which appears to be the late-limiting step in short-patch BER [64], may be critical in determining the mode of BER DNA protein crosslink formation in the short-patch BER of dL Chemical methods ... monofunctional DNA glycosylases [39,41,62,63] As measured by an in vivo assay using a plasmid containing a single AP site in the stop codon of the gene encoding enhanced green fluorescent protein, > 80%...
- 10
- 356
- 0
Molecular Biotechnology-Lession 3: Basic techniques in DNA technology ppt
Ngày tải lên :
23/03/2014, 22:20
... Components in PCR reaction Template DNA Primers dNTPs Taq DNA polymerase Buffer Steps programmed in PCR Step 1: Denature DNA, 95oC, 5min Step 2: Annealing: - Denature DNA, 950C, 30s-1min ... Annealing: - Denature DNA, 950C, 30s-1min - Annealing, 55-60oC, 1min Step 3: Extension, 70-72oC, 30s-1min Go to step 2, 32 cycles Step 4: Holding, 4oC, 0s Primers (short DNA fragments) containing ... copies of DNA Total copies = 2n where n is the number of cycles to copy DNA So basically it is the cycles of heating and cooling (thermal cycling) Applications of PCR DNA cloning DNA based...
- 62
- 415
- 1
Báo cáo khoa học: Interaction of selenium compounds with zinc finger proteins involved in DNA repair pdf
Ngày tải lên :
30/03/2014, 15:20
... its zinc finger motif is not directly involved in DNA binding, it is required for the correct folding of the minimal DNAbinding domain [50]; substitution of any of its zinccomplexing cysteines ... elucidated In the cytosol of cells, MT is present in excess over DNA repair proteins; however, owing to the coupling of zinc-binding structures (either in MT or in zinc finger proteins) by selenium ... that is mostly involved in DNA binding but also in protein–protein interactions [17] Originally identified as being present in different transcription factors, it is now known that zinc finger structures...
- 10
- 374
- 0
Báo cáo khoa học: Histone H2A phosphorylation in DNA double-strand break repair pot
Ngày tải lên :
30/03/2014, 20:20
... tail that were either unmodified or contained a phosphoserine residue in the SQ motif Proteins containing known phosphoserine ⁄ threonine binding motifs such as BRCT or FHA domains may bind to some ... ‘see’ phosphorylated H2AX in mitotically dividing cells In addition, the binding and accumulation of chromatin-modifying complexes to DNA breaks in yeast was examined in asynchronous haploid cell ... to DNA breaks At least for Ino80, this may involve the Nhp10 protein, identified as important for Ino80-binding chromatin near DNA breaks [30] As the Ino80 complex from an nhp10 mutant strain...
- 10
- 321
- 0
Báo cáo hóa học: " Research Article Short Exon Detection in DNA Sequences Based on Multifeature Spectral Analysis" potx
Ngày tải lên :
21/06/2014, 09:20
... processing methods to analyze a DNA sequence The solution to this problem is that we can deploy a moving window For each window location, we analyze only the data within the window The idea behind ... processing However, we are only interested in the 1/3 frequency component rather than the full frequency spectrum at each base along the DNA sequence in the exon detection process In addition, we ... resolution we get and vice versa As a result, in order to obtain more accurate information in both frequency and location aspects, we process the signals using several different moving window sizes...
- 8
- 388
- 0
Báo cáo hóa học: " Research Article A Novel Signal Processing Measure to Identify Exact and Inexact Tandem Repeat Patterns in DNA Sequences" potx
Ngày tải lên :
22/06/2014, 19:20
... identifying tandem repeats in DNA sequence based on sum spectra The sum spectra measure is obtained by summing up the spectra of each binary subsequence However, in case of InTR, not all the binary ... the complete input DNA sequence in one go, we divide the DNA sequence into a set of subsequences defined by a pointwise multiplication of the original DNA sequence by a stationary window The EPSD ... identify periods in DNA sequences, there is one major difference Instead of looking for periods that are present in entire input DNA sequence, we have to look for local periodic information because...
- 7
- 206
- 0
Báo cáo hóa học: " Research Article A Novel Signal Processing Measure to Identify Exact and Inexact Tandem Repeat Patterns in DNA Sequences" pdf
Ngày tải lên :
22/06/2014, 22:20
... identifying tandem repeats in DNA sequence based on sum spectra The sum spectra measure is obtained by summing up the spectra of each binary subsequence However, in case of InTR, not all the binary ... the complete input DNA sequence in one go, we divide the DNA sequence into a set of subsequences defined by a pointwise multiplication of the original DNA sequence by a stationary window The EPSD ... identify periods in DNA sequences, there is one major difference Instead of looking for periods that are present in entire input DNA sequence, we have to look for local periodic information because...
- 7
- 391
- 0
SELECTED TOPICS IN DNA REPAIR docx
Ngày tải lên :
27/06/2014, 19:20
... structures in their DNA binding motifs Within these structures, zinc is complexed to four cysteines and/or histidines, folding different structural domains mediating DNA- protein as well as protein-protein ... spectrum of DNA lesions including binary DNA adducts, DNA interstrand crosslinks (ICLs), DNAprotein adducts, DNA double-strand breaks and Interactions by Carcinogenic Metal Compounds with DNA Repair ... essential cysteines and/or other residues in zinc finger structures interfering in metal binding domain Taken together, the above mentioned mechanisms indicate that DNA repair, zinc homeostasis,...
- 582
- 590
- 0
Báo cáo y học: " Standards of lithium monitoring in mental health trusts in the UK" pot
Ngày tải lên :
11/08/2014, 16:22
... following tests/measures should be undertaken before initiating treatment with lithium: (a) renal function tests; urea and electrolytes (U&Es) including creatinine (or e-GFR or creatinine clearance); ... these inconsistent findings [26] There may also be variation between clinicians in the acceptance of the need for monitoring at the frequency recommended by NICE The use of incentivised care in ... about treatment including how to avoid toxicity, and a biochemical monitoring record [33,34] The deadline for getting information to patients and having these monitoring systems in place is December...
- 7
- 562
- 0
Báo cáo y học: "APOBEC3G induces a hypermutation gradient: purifying selection at multiple steps during HIV-1 replication results in levels of G-to-A mutations that are high in DNA, intermediate in cellular viral RNA, and low in virion RNA" pps
Ngày tải lên :
13/08/2014, 05:21
... mutations being the highest in viral DNA, intermediate in cRNA, and lowest in vRNA We also determined the frequency of G-to-A mutations present in vRNA obtained from HIV WT virus infections We found ... containing mutations in Vif residues involved in interactions with A3G displayed reduced fitness in PBMC cultures; furthermore, viral DNA in these cells contained extensive G-to-A hypermutation indicative ... domains of Vif that are involved in binding to A3G and A3F [12-17] Furthermore, as a proof of principle, work by Mehle et al has shown that Vif peptides overlapping the A3G-binding domain were...
- 15
- 320
- 0
Báo cáo sinh học: " Enhancement of the expression of HCV core gene does not enhance core-specific immune response in DNA immunization: advantages of the heterologous DNA prime, protein boost immunization regimen" ppsx
Ngày tải lên :
14/08/2014, 19:22
... GATCCCTCGAGTCAAGCGGAAGCTGG containing recognition sites of HindIII and XhoI restriction endonucleases The amplified DNA was cleaved with HindIII/XhoI and inserted into pcDNA3 (Invitrogen, USA) cleaved with HindIII/XhoI ... and spleens were obtained two weeks after each immunization in Scheme I; and three and five weeks after the last immunization in Schemes II and III Murine splenocytes were harvested using red blood ... tolerability of an HIV-1 DNA prime-protein boost vaccine (DP6-001) in healthy adult volunteers Vaccine 2008, 26:4420-4424 Duenas-Carrera S: DNA vaccination against hepatitis C Curr Opin Mol Ther 2004,...
- 17
- 271
- 0
Dealing with missing values in DNA microarray
Ngày tải lên :
11/09/2015, 16:03
... containing fluorescently labeled cDNAs with DNA chip; Detecting bound cDNA using laser technology and storing data in a computer; Analyzing data using computational methods We are obviously interested ... Preparing DNA chip using the chosen target DNAs; CHAPTER THE MISSING VALUE PROBLEM IN MICROARRAY 11 Generating a hybridization solution containing a mixture of fluorescently labeled cDNAs; Incubating ... [87] were the pioneers in dealing with missing values in microarray, by proposing a method called k-nearest neighbour imputation (KNNimpute) in which the missing values are imputed using the weighted...
- 145
- 239
- 0
Asymptotic results in over and under representation of words in DNA
Ngày tải lên :
30/09/2015, 14:23
... (3.8) will be obtained when we simulate DNA sequences of finite length 3.2 Asymptotic Normality of Markov Chains In studies of DNA sequences, we usually assume that the base pairs in DNA sequences ... chain However, Theorem 3.12 gives the central limit theorem for random variables in α-mixing sequences Next, we shall study the relation between the α-mixing sequences and the Markov chains in ... extrema follow certain expressions in terms of c and c0 respectively We will present two methods in proving this theorem, one using Bonferroni’s inequalities and the other one using Poisson approximation...
- 55
- 324
- 0
Constraint based method for finding motifs in DNA sequences
Ngày tải lên :
03/10/2015, 21:58
... localization by (e.g.) linkage mapping, followed by cloning out and finally sequencing a minimal region of interest The cost and time required to sequence DNA made sequencing a tool to be applied ... analysis, we review the existing motif finding algorithms Finally we revisit the significance of our algorithms Chapter introduces two novel algorithms, namely constraint mechanismbased motif finding ... the DNA to which they bind, again changing the binding affinity of the polymerase [38, 39] CHAPTER BACKGROUND Prom oter Region RN A p o ly m erase A: Binding Site R No Transcription Gene T erm ination...
- 80
- 310
- 0
Crystallographic studies on geminin CDT1 complex, proteins involved in DNA replication
Ngày tải lên :
04/10/2015, 10:24
... points 23 FIGURE 2.1 DNA replication licensing control by Geminin and CDKs 42 during the cell cycle FIGURE 2.2 Geminin Binding Domain of Human Cdt1 and Cdt1 44 Binding Domain of Human Geminin ... information will prove useful in elucidating how Cdt1 and Geminin interact at the protein level We identified, cloned and expressed (in bacterial cells) the geminin-binding domain of human Cdt1 and purified ... central role in controlling the timing of chromatin licensing Chromatin binding of both Cdc6/18 and Cdt1 depends on the presence of ORC on origin DNA, but these two factors bind independently...
- 99
- 230
- 0
Role of BRCA2 in DNA repair
Ngày tải lên :
16/10/2015, 15:35
... sufficient for the transportation of BRCA2 into the nucleus. This region also harbours many protein interacting domains such as the FANCD2 interacting region, oligobinding (OB) domain and a Rad51 binding domain. Many ... proper folding of the C‐terminus to its active configuration (Kanugula, 2003). The C‐terminal domain contains the DNA binding site and the cysteine containing active site that binds ... DNA can be damaged by mutagens which can alter DNA bases and thus the coding sequence. Both intrinsic and extrinsic mutagenic agents are capable of causing distinctive DNA damage. The intrinsic mutagenic agents include cellular metabolites, ...
- 157
- 164
- 0
Báo cáo y học: "Translational Medicine and Reliability of Single-Nucleotide Polymorphism Studies: Can We Believe in SNP Reports or Not"
Ngày tải lên :
25/10/2012, 10:51
... studies analysing a determined polymorphisms between the studies examining it within 1-3 polymorphisms versus studies examining the same polymorphism among more than polymorphism Since the distribution ... Reports (Institute for Scientific Information, JCR-ISI) [9] When a journal was not included in the citation index, we set as IF The number of citations was obtained though the Science Citation Index ... usefulness of certain polymorphisms as prognostic genetic markers It may also have direct impact in medical research by guiding researchers and funding sources in investigating insignificant genes...
- 9
- 524
- 0
Báo cáo y học: " Helicobacter pylori induces mitochondrial DNA mutation and reactive oxygen species level in AGS cells"
Ngày tải lên :
25/10/2012, 11:18
... Medicine 57 Reagents F12 culture medium (Hangzhou Jino Biology Co., Ltd China), fetal bovine serum (FBS), ampicillin, penicillin and streptomycin (Shanghai Bio-engineering Co., Ltd China), brain ... O2, 85% N2, 10% CO2) with continuous shaking E coli were maintained in the LB liquid medium (containing 100 µg/ml ampicillin) at 37°C for 12 h with continuous shaking Preparation of Hp and E.coli ... down-regulated both in vitro and in vivo Moreover, Hp induces genomic instability in nuclear CA repeats in mice and in mtDNA of AGS cells and chronic gastritis tissue, and this effect in mtDNA is associated...
- 12
- 557
- 2