... bronchial inflammation and airway hyperreactivity in mice Pharmacology 1997, 55:32-43 Satoh Y, Kasama K, Kuwabara M, Yimin, Diao HY, Nakajima H, Kohanawa M, Minagawa T: Suppression of late asthmatic ... of bacterial DNA Arthritis Res 2001, 3:48-53 Miyata M, Kobayashi H, Sasajima T, Sato Y, Kasukawa R: Unmethylated oligo-DNA containing CpGmotifs aggravates collageninduced arthritis in mice Arthritis ... Echtenacher B, Hehlgans T, Mannel DN: Antimetastatic effect ofCpG DNA mediated by type I IFN Cancer Res 2001, 61:5523-5528 Nakajima H, Nakao A, Watanabe Y, Yoshida S, Iwamoto I: IFN-alpha inhibits...
... with a UV detector at 232 nm The main pharmacokinetic parameters were calculated by DAS 1.0 (Anhui, China) program Bioavailability (BA) is a measurement of the rate and extent ofa therapeutically ... (Mw = 200,000) was purchased from Hayashibara (Tokyo, Japan) Epirubicin·HCl (EPI·HCl) was purchased from Hisun Pharmaceutical Co (Zhejiang, China) Poly (vinyl alcohol) (PVA) with an average molecular weight ... and the acute toxicity of PANs was evaluated in mice Morever, EPI was loaded into PANs and its pharmacokinetics was also assessed in rats to compare to the free drug Methods Materials Pullulan...
... chloride (PAC) as well as waste steel slag (WSS) (E5) A natural tidal flat (C3) at the same tidal level was chosen asa reference for monitoring benthic communities as well as physicochemical characteristics ... in artificial tidal flats in Japan, a growth test of R philippinarum was also carried out in DS mixtures MATERIALS AND METHODS Artificial tidal flats in real seashore Five artificial tidal flats ... 2009 Fig Location of the artificial and natural tidal flats in Tategami, Ago bay, Mie, Japan Table Sediment of artificial tidal flats in real seashore Run E1 E2 E3 E4 E5 Granulation of DS 1.5wt%...
... And such a whole suite of accessory enzymes is required for efficient xylan hydrolysis such as α-arabinofuranosidases and α-Larabinases that release arabinan [31], α-glucuronidases that release ... acetic acid Organic solvent such as acetone can be used to precipitate and separate the fractionated biomass The pretreatment has an advantage of operating at low temperature (50 °C) which capital ... feasible as great amounts of this valuable commodity would be wasted Besides lignin, miscellaneous components of wheat straw such as wax, pectin, and phenolic acids are also of great value and...
... women ofa certain age a reasonable measure of the lack of availability of partners for single men of the same age group (and vice-versa)? Despite the existence of age discrepant couples, age homophily ... the ACS) The higher rate of interraciality in HCMST is mainly due to the fact that the HCMST survey was offered only in English, whereas the ACS was offered in a variety of languages Asians and ... Hypothesis Partnership Rate Although the association between Internet access at home and having a romantic partner is a strong and statistically significant association, several important caveats apply...
... phosphate asa substrate for localization of the labeled MYP Statistical analysis Data were expressed as the mean ± SEM Statistical analysis was performed using instat software (GraphPad Software) The ... testis at stage 1, and eggs In all of the samples analyzed, a large protein peak was observed at an elution position of 72 mL (peaks a, b, c, and d), where the estimated molecular mass was about ... measured by the Bradford method [51] using a Bio-Rad protein assay (Bio-Rad, Hercules, CA, USA) with bovine c-globulin asa standard Thyroglobulin (669 kDa), catalase (232 kDa), BSA (67 kDa) and...
... (2000) Autophagy asa regulated pathway of cellular degradation Science 290, 1717–1721 23 Marzella, L., Ahlberg, J & Glaumann, H (1981) Autophagy, heterophagy, microautophagy and crinophagy as the ... mitochondria have a replicative advantage over normal mitochondria [56,57] Analogous selection for dysfunctional mitochondria may also occur in the case of aging; Wanagat et al recently reported that atrophic ... initiating the age-related accumulation of garbage Given this, it is reasonable to expect a further decrease in autophagocytotic capacity at old age and this may be related to the progressive accumulation...
... GTTGGTCTCGTCGCTCATCACATCACGAGG GCTTGAAGGCGCTGGATCTGCGACAATAG GACTGGGCTTTCATCAGCGACAGGTGGC GTGAACCACCAAAATCGGAGAACGAAGC CAGGTTCTCAGTAGAGCCAATCTTCGACCTGAC AGAGTCGGATGCAGTTGCCCGGGCAACA GGCTCCTCCAGCACCCTCCGGGTCCCG ... GGCTCCTCCAGCACCCTCCGGGTCCCG CCCCAAACTTGTGACCATCATTC GGAGAAATCATCTTGAGCATAGCG CGAACTCTCAAGGGC ATGCATCAGAACCATGCACG AGCCCTACAATTCCATCCTCACC GCTGAAGGAGACGATGAGGGTGA 82898–82923 83581–83552 91489–91517 ... no MAP band was observed (not shown) Gene and mRNA analyses of MAP1b, MAP2, Tau, and STOP The finding that apparently normal neurites are formed even when CAD cells lack MAP1b, MAP2, Tau, and...
... Madeleine Hackney and a grant from the American Parkinson Disease Association to Gammon Earhart References Argue, J (2000) Parkinson’s disease and the art of moving Oakland, CA: New Harbinger Beauchet, ... found that the waltz was just as good as traditional aerobic exercise and that people were happier, which was demonstrated by increases in a measure of quality of life, and greater likeliness ... the wand backwards (arms still behind chair) e Finger roll: As fast as you can, then as slow as you can; Rolling out to the sides of the wand, and back to center Come up with your own plan! From...
... metabolism? Proc Natl Acad Sci USA 93, 15086–15091 Saito, Y., Hayashi, T., Tanaka, A. , Watanabe, Y., Suzuki, M., Saito, E & Takahashi, K (1999) Selenoprotein P in human plasma as an extracellular ... essential trace nutrient for growth of WI-38 diploid human fibroblasts Proc Natl Acad Sci U.S .A 73, 2023–2027 Takahashi, K., Akasaka, M., Yamamoto, Y., Kobayashi, C., Mizoguchi, J & Koyama, J (1990) ... hydroperoxide was added [15] The oxidation of NADPH was followed at 340 nm at 37 °C and activity was expressed as micromoles of NADPH oxidized per minute TR enzyme assay TR activity was examined by...
... face and the voice went away Sorry because he was afraid Afraid that it was some disease Canker was a disease of plants and cancer one of animals: or another different That was a long time ago ... prefect was there again and it was his voice that was saying that he was to get up, that Father Minister had said 22 A Portrait of the Artist asa Young Man he was to get up and dress and go to ... face was pale and strange and he wore the white cloak ofa marshal O how cold and strange it was to think of that! All the dark was cold and strange There were pale strange faces there, great...
... is to have most of the main data-set replicated across all the sites and transmit only incremental changes Furthermore the main data-set is often cached locally at each of the collaborating sites ... reconstruct a missing packet The virtual representation ofa remote collaborator (avatar) is often captured as the position and orientation of the 3D tracking devices that are attached to the ... data to a multicast address and the routers that receive the data send copies of the data to remote sites that are subscribed to the multicast address One drawback of multicast is that it is often...
... rise as, in all probability they will, a rise in wages will be imperative This, in the case of railways would mean an increase in rates, as there are few who are earning more than a reasonable ... commercial development there is certain of an unfavourable reception But as sand and mud are the only base from Santa Fé to Bahia Blanca—in some cases there being not even firm sand—and as dredging ... goods as “ponchos” has lapsed in favour of German and Italian wares While the manufacture of matches—in the hands ofa powerful monopoly, bolstered up by privileges and an exorbitant duty— was so...
... kept as dependent variables Moreover, total capital (CAPITAL) and total turnover (TURNOVER) of each a liate are taken from the MiDi database As unpaid dividends and interest of financial assets may ... empirical analysis, the MiDi database for multinationals, provided by the Deutsche Bundesbank, is used This database contains financial statements of German FDI as well as additional information about ... directly on balance sheet items reflecting intrafirm sales The analysis is based on the MiDi database, a comprehensive micro-level panel database of virtually all German multinationals, made available...
... transfer half the number of sperm of normal males After 24 hours, the proportion ofa male’s sperm in storage was the same, irrespective of male genotype However, four days after mating, there was a ... sperm-storage organ are potentially damaging to sperm, and large ejaculates may be better able to buffer against female spermicide and hence survive longer Certainly the uterus ofa female Drosophila ... mated normal males, which transfer smaller ejaculates Angelard and co-workers also allowed females to remate with a second male, allowing either sperm transfer or interrupting the mating to allow...
... tsom si ydalam siht dna sulahpecordyh latinegnoc ot desopsiderp era sauhauhihC aixata htiw detneserp saw muiravlac depahs-emod a htiw god auhauhihC a ,esac siht nI ]3[ erusserp lainarcartni eht ... sisenegohtap eht ,revewoh ,]9[ aileymognirys fo esuac gnidael a si noitamroflam I iraihC ]8[ ecnatsbus lamyhcnerap eht nihtiw eil yam ti ro lanac lartnec eht fo noitatalid a yb demrof eb yam ytivac ... noitainreh drawnwod eht sa denifed yllanoitidart neeb sah taht nigiro niatrecnu na fo redrosid a si noitamroflam I iraihC )2 giF( aileymognirys dna noitamroflam I iraihC osla tub ,selcirtnev laretal eht...
... larger datasets and results of ongoing adjuvant trials are needed to provide confirmatory evidence for or against the concept and feasibility of withdrawal therapy in locally advanced and metastatic ... Segaloff A, Rubens RD: Assessment of response to therapy in advanced breast cancer: a project of the Programme on Clinical Oncology of the International Union Against Cancer, Geneva, Switzerland Cancer ... breastinternationalgroup.org/LinkClick.aspx?fileticket=dmcZc0avwBc% 3d&tabid=2341] doi:10.1186/1477-7819-9-101 Cite this article as: Agrawal et al.: Clinical relevance of “withdrawal therapy” as...
... [Tumor marker in primary lung cancer] J UOEH 2004, 26:473-479 38 Suzuki A, Yamada R, Chang X, Tokuhiro S, Sawada T, Suzuki M, Nagasaki M, Nakayama-Hamada M, Kawaida R, Ono M, et al.: Functional haplotypes ... novel antigen-antibody system specific for rheumatoid arthritis J Rheumatol 1994, 21:1027-1033 Nakashima K, Hagiwara T, Ishigami A, Nagata S, Asaga H, Kuramoto M, Senshu T, Yamada M: Molecular characterization ... Identification of the 47 kDa autoantigen as citrullinated α-enolase The deiminated S100 fraction was separated by one-dimensional SDS-PAGE and stained with Coomassie blue; the putative band recognised...
... intention and behaviour, because the behaviour data were at a practice level, a summary measure of intention for each practice had to be calculated This was generated in two ways – by taking the mean ... doctor, a score for each construct in the TPB model was calculated as the mean of all items contributing to the construct Cronbach’s alpha was used to ascertain the reliability of each of the scales ... implication for statistical analysis was that some measure of practice-level psychological cognitions had to be derived An obvious summary measure is the mean cognition of the primary care doctors...