... PROBABILISTIC VERIFICATION AND ANALYSIS OF BIOPATHWAY DYNAMICS SUCHEENDRA KUMAR PALANIAPPAN NATIONAL UNIVERSITY OF SINGAPORE 2013 PROBABILISTIC VERIFICATION AND ANALYSIS OF BIOPATHWAY DYNAMICS ... of values The noisiness and the cell-population-based nature of the experimental... study of basic unit of life, namely, the cell The molecular composition of parts of a cell and ... natural and succinct model to work with. Consequently, our work concerns the analysis of DBN models of biopathways from a model checking point of view. Specifically, we first consider the problem of...
Ngày tải lên: 10/09/2015, 09:25
... VERIFICATION AND ANALYSIS OF WEB SERVICE COMPOSITION TAN TIAN HUAT NATIONAL UNIVERSITY OF SINGAPORE 2013 VERIFICATION AND ANALYSIS OF WEB SERVICE COMPOSITION ... encouragement and help of people around me, who give me valuable instructions and assistance during the whole of my Ph.D. journey. First and foremost, I would like to give my deepest and heartfelt ... Ling, and all the juniors for your support and friendships through my Ph.D. study. And I am grateful to all my colleagues and friends in PAT group, NUS and elsewhere for their support and encouragement...
Ngày tải lên: 10/09/2015, 09:21
Báo cáo y học: " NF- B subunits RELB C-Rel RELA p50 p52 bound DNA b EMS" docx
... Jolma and co-workers obtained comparable datasets using between two and four rounds of SELEX [8] Profiling of NF-B p52p52 from SELEX1 and SELEX3 revealed there was an over-representation of sequences ... Binding affinity of dimer for 11-mer sequence (z-score) Figure Binding profiles of the different NF-B dimers Heat map illustration of binding profiles obtained from microarray analysis of dimers Within ... again, the profile of RELARELA was distinct from that of the heterodimers RELAp50 and RELAp52 (Table 2) This is consistent with what we observed using microarrays where binding profiles of the two...
Ngày tải lên: 09/08/2014, 23:20
Báo cáo khoa học: Helicobacter pylori single-stranded DNA binding protein – functional characterization and modulation of H. pylori DnaB helicase activity pptx
... indicates the position of the ssDNA in the absence of SSB protein and the subsequent retardation of the band with an increasing amount of SSB is also shown *Position of the double-stranded control DNA ... Effect of HpSSB on ATPase activity of HpDnaB in the presence of ssDNA The release of radiolabeled Pi from (c-32P)ATP was monitored in the absence and presence of different concentrations of HpSSB ... Wt and DC20 SSB protein in varying concentrations (0, 0.45, 0.9, 1.8, 2.7 and 3.6 lg, respectively) with 300 ng of M13mp18 single-stranded circular DNA and ⁄ or 300 ng of pUC18 double-stranded...
Ngày tải lên: 30/03/2014, 02:20
Báo cáo y học: " A balanced transcription between telomerase and the telomeric DNA-binding proteins TRF1, TRF2 and Pot1 in resting, activated, HTLV-1-transformed and Tax-expressing human T lymphocytes" pot
... hTERT A) Flow cytometry determination of the expression of GFP and p19gag The percentage of cells in each quadrant is indicated B) Analysis of hTERT, and of telomere protein gene expression in ... transcription of TERF1 and of TERF2 underwent an increase of 1.2 to 2.4, and of 2.7 to 4.0, respectively, the transcription of POT1 rose at a much higher level (Fig 2) Indeed, the amount of Pot1 in ... activation of CD4+ T cells reveals an inverse regulation in the transcription of telomerase and that of POT1, TERF1 and TERF2 genes Transcriptional expression of hTERT, POT1, TERF1 and TERF2 genes...
Ngày tải lên: 13/08/2014, 09:21
Tài liệu Báo cáo khoa học: Steady-state and time-resolved fluorescence studies of conformational changes induced by cyclic AMP and DNA binding to cyclic AMP receptor protein from Escherichia coli ppt
... change in Trp13 as a function of cAMP concentration F and F0 are the uorescence intensities of the protein in the presence and absence of the ligand, respectively The range of cAMP concentrations used ... change in Trp85 as a function of cAMP concentration F and F0 are the uorescence intensities of the protein in the presence and absence of the ligand, respectively The range of cAMP concentrations used ... the calculated average values of uorescence lifetimes ặsDổ and ặsDAổ The values for average lifetimes of Trp85 in the absence and presence of acceptor and efciency of energy transfer are presented...
Ngày tải lên: 20/02/2014, 23:20
Báo cáo khoa học: Characterization of HbpR binding by site-directed mutagenesis of its DNA-binding site and by deletion of the effector domain pot
... temperature) and resuspended in Mops medium [5.5 gÆL)1 of Mops free acid, 5.1 gÆL)1 of Mops sodium salt, 0.5 gÆL)1 of NaCl, gÆL)1 of NH4Cl, 0.06 gÆL)1 of Na2HPO4Æ2H2O, 0.05 gÆL)1 of KH2PO4, mm ... Physical and functional analysis of the prokaryotic enhancer of the r54-promoters of the TOL plasmid of Pseudomonas putida J Mol Biol 258, 562–574 22 Sze CC, Laurie AD & Shingler V (2001) In vivo and ... (devoid of parts of their A-domain) were constructed One of these, the DA-HbpR variant (in plasmid 1759 HbpR-binding site D Tropel and J R van der Meer Fig DNaseI footprinting analysis of the...
Ngày tải lên: 07/03/2014, 17:20
Tài liệu Báo cáo khoa học: The stereochemistry of benzo[a]pyrene-2¢-deoxyguanosine adducts affects DNA methylation by SssI and HhaI DNA methyltransferases pptx
... conformation of the (+)-cis adduct and the minorgroove conformation of the (+)-trans adduct, the latter interfering with interactions of the catalytic loops of the MTases and the minor groove of DNA ... alone and in complexes with MTases, the fluorescence intensities at 384 nm were calculated Determination of the amounts of the active form of M.SssI and M.HhaI The amount of the active form of M.SssI ... with the levels of DNA methylation, and thus the effect of the absolute configurations and conformations of the adducts on DNA methylation was not evaluated More recently, the effect of stereochemically...
Ngày tải lên: 19/02/2014, 00:20
Tài liệu Báo cáo khoa học: DNA modification with cisplatin affects sequence-specific DNA binding of p53 and p73 proteins in a target site-dependent manner pptx
... the p53 protein and activate an analogous set of downstream genes Multiple splice isoforms of the p73 protein have been found that differ in the structure of their N-terminal and ⁄ or C-terminal ... DNA comprises about 50% of 1,2-GG IACs, 25% of 1,2-AG IACs, 10% of 1,3-GNG IACs and interstrand crosslinks, and another 2–3% of monofunctional adducts It has been found that cisplatin cytotoxicity ... respective supershifted bands are denoted as SR53, SR73d and SR73b; the presence of two supershifted bands in each of the lanes 5–7 corresponds to two possible stoichiometries of the antibody–protein...
Ngày tải lên: 19/02/2014, 05:20
Tài liệu Báo cáo khoa học: Roles of the human Rad51 L1 and L2 loops in DNA binding doc
... eukaryotic and archaeal proteins (Fig 1A) Like the case of bacterial RecA, the L1 and L2 loops of the eukaryotic Rad51 proteins face A Roles of the HsRad51 L1 and L2 loops inside of their helical ... HsRad51-L1 loop and measured the fluorescence changes of the tryptophan residues upon DNA binding Results Strategy of mutational analysis In order to study the functions of the L1 and L2 loops of HsRad51, ... Roles of the HsRad51 L1 and L2 loops D231W (L1 loop) Table Changes in the fluorescence of tryptophan probes inserted in the L1 and L2 loop upon binding of nucleotides and DNA The fluorescence of modified...
Ngày tải lên: 19/02/2014, 06:20
Báo cáo khoa học: Physicochemical properties and distinct DNA binding capacity of the repressor of temperate Staphylococcus aureus phage /11 doc
... presence of CI More precisely, the )21 to )48 and )52 to )87 regions of the top strand and )24 to )53 and )58 to )87 regions of the bottom strand were protected by CI (Fig 3B) The centers of these ... CTCGAGCATTTTAACTACGTTTG Synthesis of O1 DNA Synthesis of O2 and O1O2 DNAs Synthesis of O2 DNA Synthesis of O3 DNA Synthesis of O3 DNA Synthesis of S aureus cspC DNA Synthesis of S aureus cspC DNA (Fig ... first base of the start codon of Cro was considered as +1 and the whole sequence was numbered with respect to +1 that the intensities of six bottom strand guanine bases and five top strand guanine...
Ngày tải lên: 07/03/2014, 00:20
Báo cáo khoa học: DNA-binding characteristics of the regulator SenR in response to phosphorylation by the sensor histidine autokinase SenS from Streptomyces reticuli doc
... (located upstream of hbpS and ending at the 5¢-end of binding site III) GCCGAATTCCGCCGGACCGGATG (located upstream of hbpS and beginning at the 3¢-end of binding site III) For sequence and characteristics, ... and then cleaved with EcoRI Restricted fragments A and B (to delete site I), C and D (to delete site II), E and F (to delete site III), G and H (to delete the perfect inverted repeat) and I and ... CGAGAATTCGAAAACGAACGGTGC (located upstream of furS and ending at the 5¢-end of binding site I) GTTGAATTCTCGTGTTTATGAGGG (located upstream of furS and beginning at the 3¢-end of binding site I) GGAGCTGCAGCCCACGCGATCGCG...
Ngày tải lên: 07/03/2014, 10:20
Báo cáo khoa học: Akt-dependent phosphorylation negatively regulates the transcriptional activity of dHAND by inhibiting the DNA binding activity pdf
... mutants dHAND-Ala-X and dHAND-AlaXZ (Fig 4B) These results indicated that the major phosphorylation sites of dHAND were located within Fig Analysis of the interaction between dHAND and Akt (A) ... indicate the positions of dHAND mutants (B) Coimmunoprecipitation assay of dHAND and Akt AU5-dHAND was immunoprecipitated from the cell lysate of 293T cells expressing AU5-dHAND and HA-Akt These samples ... first analyzed the effect of phosphorylation on the transcriptional activity of dHAND using reporter assay (Fig 6A) AU5dHAND, -dHAND-Ala-X, -dHAND-Ala, and -E47 were dHAND phosphorylation by Akt...
Ngày tải lên: 07/03/2014, 16:20
Báo cáo khoa học: Transcription termination at the mouse mitochondrial H-strand promoter distal site requires an A/T rich sequence motif and sequence specific DNA binding proteins pptx
... The polarity of triangle indicates the direction of the transcription OL and OH represent the origin of L and H strand replication, respectively LSS, L strand start site; HSS, H strand start site ... downstream of the 16 S rRNA gene, and at the 5¢ end of the tRNALeu gene on mouse mt genome [15,16] Studies on S1 nuclease analysis, coupled with the 5¢- and 3¢-end mapping of D-loop H-strand coded ... representation of the mouse mt D-loop region encompassing the conserved sequence boxes I-III (CSB), tRNA genes, L and H strand promoters (LSP and HSP), L and H strand transcription start sites (LSS and...
Ngày tải lên: 08/03/2014, 08:20
Báo cáo khoa học: Pherokine-2 and -3 Two Drosophila molecules related to pheromone/odor-binding proteins induced by viral and bacterial infections ppt
... of Phk-2 in the hemolymph of DCV infected flies (A) MALDI-TOF mass spectrometry analysis of the hemolymph of single flies days after injection of buffer (Tris) or a DCV suspension The position of ... sectioned and counterstained with lead citrate and uranyl acetate MALDI-TOF MS analysis For mass spectrometry analysis, hemolymph of DCV-, or buffer-injected Drosophila was collected and directly ... MALDI-TOF mass spectrometry analysis of dissected ejaculatory bulb (G) and legs (H) showing expression of a 12.8 kDa molecule (arrow) (I) Fluorescent (hindgut) and nonfluorescent (midgut) parts of...
Ngày tải lên: 08/03/2014, 08:20
Báo cáo khoa học: pyr RNA binding to the Bacillus caldolyticus PyrR attenuation protein – characterization and regulation by uridine and guanosine nucleotides potx
... failure of a control RNA (i.e the antisense strand to BcBL1) to bind to any concentration of PyrR tested (Fig 2A) Binding of PyrR to BcBL2 and BcBL3 in standard binding buffer in the absence of effectors ... Fig Analysis of the binding of 32P-labeled BcBL2 to PyrR by the electrophoretic gel mobility shift method in the absence of effector (A) and in the presence of 500 lM GMP (B) The concentration of ... regardless of structure, whereas the specificity of purine nucleotide effects on RNA binding indicated that both the exocyclic oxo and amino groups of the purine ring and the 2¢-hydroxyl group of ribose...
Ngày tải lên: 16/03/2014, 06:20
Báo cáo khoa học: In vitro embryonic developmental phosphorylation of the cellular nucleic acid binding protein by cAMP-dependent protein kinase, and its relevance for biochemical activities pdf
... composed of unpaired strands, CNBP, hnRNP K, and additional factors [7] Modulation of the concentrations and ⁄ or the biochemical activities of either CNBP or hnRNP K could influence the ability of ... single-stranded nucleic acids and is able to promote interstrand reannealing of DNA as well as RNA [35,36] hnRNP Al is phosphorylated by CK2 and PKA PKA phosphorylation suppresses the ability of hnRNP ... and X is a variable amino acid) typical of retroviral nucleocapsid proteins and the presence of an glycine ⁄ arginine rich region (RGG) box between the first and second Zn knuckles In silico analysis...
Ngày tải lên: 16/03/2014, 12:20
Báo cáo khoa học: Recognition of DNA modified by trans-[PtCl2NH3(4hydroxymethylpyridine)] by tumor suppressor protein p53 and character of DNA adducts of this cytotoxic complex potx
... was completed, the intensities of the bands corresponding to single strands of DNA and interstrand cross-linked duplex were quantified Rearrangement of intrastrand cross-links The platinated oligodeoxyribonucleotide ... intrastrand CL of transplatin with their complementary DNA sequences results in a rearrangement of these intrastrand adducts into interstrand CLs [35] The stability of 1,3-GTG intrastrand CLs ... 1,3intrastrand CL of trans-Pt-HMP, 12% of the 1,3intrastrand CLs were transformed into the interstrand CLs Importantly, the yields of these rearrangement reactions involving the 1,3-intrastrand CLs of parent...
Ngày tải lên: 16/03/2014, 14:20