... having vested at all in the system: clearly a serious error in cost assignment. e implications for civilianization and force management deci- sions may be dramatic. First, past civilianization ... measure properly; (2) com- pared to civilian pay, military compensation is heavily weighted toward xiv The Cost of a Military Person -Year Converting a position from military to civilian has implications ... if an analytically solid estimate of the average cost of a military person -year could be produced via such an analysis, it would be of little use in practice, as every particular instance of...
Ngày tải lên: 17/02/2014, 23:20
... Counting maximal arithmetic subgroups, preprint; available on arXiV as math.GR/0501198. [2] M. Bhargava, The density of discriminants of quartic rings and fields, Ann. of Math. 162 (2005), 1 031 –10 63. [3] ——— , ... commands InvariantRing, PrimaryInvariants, and SecondaryInvariants in Magma.) One checks that R = R/f 1 R is an integral domain. Let S be the subring of R generated by f 2 , ,f 6 and g 2 , and let ... S n -invariants in the coordinate ring of (A n ) r EXTENSIONS OF A NUMBER FIELD 731 for all i ≤ m. It follows that all archimedean absolute values of γ i for i ≤ m are bounded by a constant multiple...
Ngày tải lên: 06/03/2014, 08:21
Providing detailed guidelines for implementation of a number of articles of the law on enterprise
Ngày tải lên: 27/03/2014, 10:15
Ôn thi TN 2011 - Chủ đề : many, much, a few, few, a little, little , most, most of, a number of, a great deal of…. pps
Ngày tải lên: 28/07/2014, 07:21
diary of a very bad year - anonymous hedge fund manager, n
Ngày tải lên: 04/11/2014, 10:55
current situation of outsourcing development, a number of favorable factors promoting this industry as well as analysis of outsourcing activities FPT Software.doc
... i) What is software outsourcing, its advantages and disadvantages? ii) What is current situation of software outsourcing in Vietnam and which potentials it possesses? iii) What is FPT Software ... same situation of India 20 years ago. Vietnam already provides a lower cost alternative to India and as the wage rate differential increases over the next few years, companies will increasingly ... representative office in the USA in the near future. In fact, this outsourcing outfit has won a US$ 36 .5 million investment from private equity firm Texas Pacific and Intel Capital. In addition to its...
Ngày tải lên: 27/10/2012, 16:41
Some aspects of American culture and society in the twentieth and twenty-first centuries through a number of selected short literary works
... in particular and with our American friends in general. II.2.2. Racial discrimination Racial discrimination is as old as American history since the first black African slaves came to America over ... and farming origin supported by developed industry. Within the American society, there are many races such as white, black or African-American, American Indian or Alaska native, Asian, native ... such as fast pace of life, individualism, informality, modernity although their practice of these criteria varies in terms of degree. II.1.2. Literature II.1.2.1. Definitions Before having a discussion...
Ngày tải lên: 07/11/2012, 15:01
A Student Grammar of Spanish - Number
... amigos recibir la carta al d´ a siguiente Caminar (M)/andar hasta Correos No manejar un carro (M)/conducir un coche (Yo) entrar en la cocina y abrir la ventana Regresar a casa Escribir una carta ... de la monta˜na querer ense˜nar leer, desear invitar cenar, necesitar leer escribir, mandar llamar al plomero (M)/fontanero, aconsejar escribir, decidir mandar apagar iii Planeas ir de vacaciones. ... estad´ıstica statistics *la gente people *la malla tights *el pantal´on pants, trousers el pijama / la piyama (M) pajamas *la pinza pincers la t´actica tactics *la tropa troops Thewords asterisked...
Ngày tải lên: 01/11/2013, 06:20
Tài liệu Báo cáo khóa học: TbPDE1, a novel class I phosphodiesterase of Trypanosoma brucei pdf
... TbPDE2 family. Outside of the catalytic domain, sequence similarity decrea- ses, within 10–40 amino acids at the N-terminal side of the domain, and within 15 amino acids at its C-terminal side. Expression ... cerevisiae. Its C-terminal catalytic domain shares about 30 % amino acid identity, including all functionally important residues, with the catalytic domains of human PDEs. A fragment of TbPDE1 containing ... and represents a new family within this class. The amino acid sequence of its catalytic domain is approximately equidis- tant from those of all mammalian class I PDEs, the class I PDEs dunce of D. melanogaster,regAofD....
Ngày tải lên: 19/02/2014, 12:20
Tài liệu Báo cáo khoa học: The role of the ESSS protein in the assembly of a functional and stable mammalian mitochondrial complex I (NADH-ubiquinone oxidoreductase) pptx
... antibodies were as follows: anti-porin from Calbiochem, anti-HA from Covance BabCo, anti-mouse and anti-rabbit secondary antibodies from Bio-Rad Laboratories and Amersham Pharmacia Biotech, respectively. Antibodies ... Potluri, Nagendra Yadava and Immo E. Scheffler Division of Biology, Molecular Biology Section, University of California, San Diego, California, USA The ESSS protein is a recently identified subunit of ... probed with antisera against HA, with anti-porin, and with two other antisera against complex I proteins (MWFE and PSST). (B) BN/PAGE. Top panel: histochemical assay for NADH oxidation with n itroblu...
Ngày tải lên: 19/02/2014, 16:20
Tài liệu Báo cáo khoa học: Experimental proof for a signal peptidase I like activity in Mycoplasma pneumoniae, but absence of a gene encoding a conserved bacterial type I SPase pdf
... mollicutes differ significantly from E. coli and Gram-positive bacteria [36 ], a signal peptide of 70 amino acids is not in agreement with this multi- variate data analysis. Therefore, the simplest ... Experimental proof for a signal peptidase I like activity in Mycoplasma pneumoniae, but absence of a gene encoding a conserved bacterial type I SPase Ina Catrein, Richard Herrmann, Armin Bosserhoff ... and substrate specificity, despite the substantial sequence similarities as indicated by six distinct regions with conserved amino acids [26]. For instance, LepB from Escherichia coli is 32 3 amino...
Ngày tải lên: 19/02/2014, 18:20
Tài liệu Báo cáo khoa học: Electrostatic role of aromatic ring stacking in the pH-sensitive modulation of a chymotrypsin-type serine protease, Achromobacter protease I pdf
... I Kentaro Shiraki 1 , Shigemi Norioka 2 , Shaoliang Li 2 , Kiyonobu Yokota 3 and Fumio Sakiyama 2, * 1 School of Materials Science, Japan Advanced Institute of Science and Technology, Ishikawa, Japan; 2 Institute ... this unique aromatic stacking as a possible molecular mechanism in enzyme catalysis. Electrostatic interaction between Asp1 13 and His210 Histidine is one of the most functional amino acids among the ... minimization (Fig. 3) . The charge interaction between Asp1 13 and His210 is weakened with increasing solvent-accessibility of the His210 side-chain. In the protein interior, the dielectrostatic...
Ngày tải lên: 21/02/2014, 03:20
Báo cáo khoa học: Coordination of three and four Cu(I) to the a- and b-domain of vertebrate Zn-metallothionein-1, respectively, induces significant structural changes doc
... stoichiometries higher than five. Taken together, the initial additions of Cu (I) to each domain caused the disappearance of a large set of NOESY cross-peaks and the parallel appearance of another ... forms of mammalian MTs is rather limited. In vitro, Cu (I) titrations of isolated MT-2 and its sep- arate domains demonstrated that up to six Cu (I) ions can bind to each domain [26]. In another ... solution structure of the C-terminal a- domain has become available. The data revealed a tertiary fold very similar to that of MT-1 and MT-2, except for a loop that contains an acidic insertion that...
Ngày tải lên: 07/03/2014, 09:20
Báo cáo khoa học: Identification and characterization of a nuclear receptor subfamily I member in the Platyhelminth Schistosoma mansoni (SmNR1) pot
... DNA and drive transcription in a mammalian cell reporter gene assay in in vivo results. Experimental procedures Parasites The NMRI strain of S. mansoni was maintained in snails (Biomphalaria ... splice site of A DNA binding domain B Ligand binding domain Fig. 1. Sequence alignment. (A) Alignment of DNA binding domain (C domain) and its C-terminal extension. (B) Alignment of ligand binding ... gene in mammalian cells suggests that SmNR1 ⁄ SmRXR1 can interact with mammalian coac- tivators of transcription, and S. mansoni coactivators of transcription may have a similar mechanism to SmNR1...
Ngày tải lên: 07/03/2014, 11:20
Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot
... CLAP_1:AA GATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 1888 CLAP_2:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA (A) 48 1870 Fig. 7. Nucleotide ... CLAP_2:AAGTCTGTCGTCAAAATGTTATGAACGTCTCTTGTCATAAAGAAAGAGAACCTCTCTTTTTAGTTTGGTTTAGATATTAAGGACAGATCCAAAATATTTG 1 132 * CLAP_1:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTA AAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT ... CLAP_1:ATTCTCCTGGCATTAAAGATGGAATGGAGGGAACCACGATGCAAGGAAAGAGTCTCATATTTTCAATCAAAGATGGTGAGGTTATAATCAACAGCAAGAC 900 CLAP_2:ATTCTCCTGGCATTAAAGATGGAATGGAGGGAACCACGATGCAAGGAAAGAGTCTCATATTTTCAATCAAAGATGGTGAGGTTATAATCAACAGCAAGAC...
Ngày tải lên: 07/03/2014, 16:20
Cách sử dụng (Something) is down to (a number of something) pdf
... me, Claire, and Maria - Hiện giờ chỉ còn t i, Claire và Maria. Lưu ý rằng khi sử dụng “down to” thường kèm “now”, ở đâu đó trong câu. V i b i viết Daily English Speaking Lesson này, ... half a bag of rice” = “chúng t i giờ chỉ còn n a bao gạo”. Thông thường bạn n i về số lượng sự vật/ đồ vật bị giảm, nhưng bạn cũng có thể liệt kê như: Now it’s down to just me, Claire, and ... ty c a bạn v a gặp ph i chút rắc r i. Phần lớn nhân viên trong bộ phận c a bạn đều bị sa th i. Và giờ chỉ có bạn, sếp c a bạn và 1 nhân viên n a. Bạn n i chuyện v i bạn c a mình về tình huống...
Ngày tải lên: 10/03/2014, 11:20