i think of a number worksheet ks3
Đề tài " The number of extensions of a number field with fixed degree and bounded discriminant " docx
Ngày tải lên :
06/03/2014, 08:21
... Belolipetsky, Counting maximal arithmetic subgroups, preprint; available on arXiV
as math.GR/0501198.
[2]
M. Bhargava, The density of discriminants of quartic rings and fields, Ann. of Math.
162 (2005), ... commands InvariantRing,
PrimaryInvariants, and SecondaryInvariants in Magma.) One checks that
R = R/f
1
R is an integral domain.
Let S be the subring of
R generated by f
2
, ,f
6
and g
2
, and let ... S
n
-invariants in the coordinate ring of (A
n
)
r
EXTENSIONS OF A NUMBER FIELD
731
for all i ≤ m. It follows that all archimedean absolute values of γ
i
for i ≤ m
are bounded by a constant multiple...
- 20
- 478
- 0
Providing detailed guidelines for implementation of a number of articles of the law on enterprise
Ngày tải lên :
27/03/2014, 10:15
... owned
capital 11
Article 18 Implementation of a capital contribution in, and rights and obligations related to capital
contribution in a multiple member limited liability company 11
Article ...
3. Individual family household businesses.
4. Other organizations and individuals involved in the establi
shment, managerial organization and
operation, reorganization and dissolution of ... occupational-professional association to
which the State delegates authority to issue practising certificates, to individuals with the professional
qualifications and experience required for a certain...
- 28
- 630
- 0
current situation of outsourcing development, a number of favorable factors promoting this industry as well as analysis of outsourcing activities FPT Software.doc
Ngày tải lên :
27/10/2012, 16:41
... CONTENTS
Acknowledgements i
Abstract ii
List of Abbreviations iii
List of Charts and Tables iv
INTRODUCTION 1
I. Rationale 1
II. The significance of the study 2
III. Aims of the study 2
IV. Research ... i) What is software outsourcing, its advantages and disadvantages?
ii) What is current situation of software outsourcing in Vietnam and which
potentials it possesses?
iii) What is FPT Software ... is positioned to
participate fully in this market. At present, despite the rapid increase in both quality
and quantities, the total value of this market is still relatively small in comparison...
- 79
- 611
- 6
Some aspects of American culture and society in the twentieth and twenty-first centuries through a number of selected short literary works
Ngày tải lên :
07/11/2012, 15:01
... in particular and with our American friends in general.
II.2.2. Racial discrimination
Racial discrimination is as old as American history since the first black African slaves came to
America over ... and farming origin
supported by developed industry. Within the American society, there are many races such as
white, black or African-American, American Indian or Alaska native, Asian, native ... such as fast pace of life, individualism, informality, modernity although their practice of
these criteria varies in terms of degree.
II.1.2. Literature
II.1.2.1. Definitions
Before having a discussion...
- 49
- 785
- 1
A Student Grammar of Spanish - Number
Ngày tải lên :
01/11/2013, 06:20
... amigos recibir la carta al d´ a siguiente
Caminar (M)/andar hasta Correos
No manejar un carro (M)/conducir un coche
(Yo) entrar en la cocina y abrir la ventana
Regresar a casa
Escribir una carta ... de la monta˜na
querer ense˜nar leer, desear invitar cenar, necesitar leer escribir, mandar llamar al plomero
(M)/fontanero, aconsejar escribir, decidir mandar apagar
iii Planeas ir de vacaciones. ... estad´ıstica statistics
*la gente people
*la malla tights
*el pantal´on pants, trousers
el pijama / la piyama (M) pajamas
*la pinza pincers
la t´actica tactics
*la tropa troops
Thewords asterisked...
- 14
- 571
- 1
Tài liệu Báo cáo khóa học: TbPDE1, a novel class I phosphodiesterase of Trypanosoma brucei pdf
Ngày tải lên :
19/02/2014, 12:20
... TbPDE2 family.
Outside of the catalytic domain, sequence similarity decrea-
ses, within 10–40 amino acids at the N-terminal side of the
domain, and within 15 amino acids at its C-terminal side.
Expression ... C-terminal catalytic domain shares
about 30% amino acid identity, including all functionally
important residues, with the catalytic domains of human
PDEs. A fragment of TbPDE1 containing the catalytic
domaincouldbeexpressedinactiveforminEscherichia ... new family within this class. The amino acid
sequence of its catalytic domain is approximately equidis-
tant from those of all mammalian class I PDEs, the class I
PDEs dunce of D. melanogaster,regAofD....
- 11
- 566
- 0
Tài liệu Báo cáo khoa học: The role of the ESSS protein in the assembly of a functional and stable mammalian mitochondrial complex I (NADH-ubiquinone oxidoreductase) pptx
Ngày tải lên :
19/02/2014, 16:20
... Section, University of California, San Diego, California, USA
The ESSS protein is a recently identified subunit of mam-
malian mitochondrial complex I. It is a relatively small
integral membrane ... omplex II. Sources of other antibodies
were as follows: anti-porin from Calbiochem, anti-HA from
Covance BabCo, anti-mouse and anti-rabbit secondary
antibodies from Bio-Rad Laboratories and Amersham
Pharmacia ... assembly of a functional and stable
mammalian mitochondrial complex I (NADH-ubiquinone
oxidoreductase)
Prasanth Potluri, Nagendra Yadava and Immo E. Scheffler
Division of Biology, Molecular Biology...
- 9
- 622
- 0
Tài liệu Báo cáo khoa học: Experimental proof for a signal peptidase I like activity in Mycoplasma pneumoniae, but absence of a gene encoding a conserved bacterial type I SPase pdf
Ngày tải lên :
19/02/2014, 18:20
... the
asparagine in position 26 was labeled within the intact
protein at its a- amino group and represents the amino
terminal amino acid of P40. The efficiency of this
reaction was quite high, as ... mollicutes differ significantly from
E. coli and Gram-positive bacteria [36], a signal peptide
of 70 amino acids is not in agreement with this multi-
variate data analysis. Therefore, the simplest ... substrate
specificity, despite the substantial sequence similarities
as indicated by six distinct regions with conserved
amino acids [26]. For instance, LepB from Escherichia
coli is 323 amino acids long and...
- 9
- 559
- 1
Tài liệu Báo cáo khoa học: Electrostatic role of aromatic ring stacking in the pH-sensitive modulation of a chymotrypsin-type serine protease, Achromobacter protease I pdf
Ngày tải lên :
21/02/2014, 03:20
... I
Kentaro Shiraki
1
, Shigemi Norioka
2
, Shaoliang Li
2
, Kiyonobu Yokota
3
and Fumio Sakiyama
2,
*
1
School of Materials Science, Japan Advanced Institute of Science and Technology, Ishikawa, Japan;
2
Institute ... protease I (API) has a unique region of
aromatic ring stacking with Trp169–His210 in close proxi-
mity to the catalytic triad. This paper reveals the electrostatic
role of aromatic stacking in ... this unique
aromatic stacking as a possible molecular mechanism in
enzyme catalysis.
Electrostatic interaction between Asp113 and His210
Histidine is one of the most functional amino acids among
the...
- 7
- 603
- 0
Báo cáo khoa học: Coordination of three and four Cu(I) to the a- and b-domain of vertebrate Zn-metallothionein-1, respectively, induces significant structural changes doc
Ngày tải lên :
07/03/2014, 09:20
... synthetic a- domain of murine
MT-1.
Fig. S2. Averaged positive-ion mode ESI mass spectra
acquired from the synthetic b-domain of murine
MT-1.
This material is available as part of the online article
from ... similarity. This could indi-
cate that each domain adapts to host the additional
copper (I) ions by opening up and rearranging its
N- and C-terminal parts, minimizing the structural
perturbation ... stoichiometries higher than five.
Taken together, the initial additions of Cu (I) to each
domain caused the disappearance of a large set of
NOESY cross-peaks and the parallel appearance of
another...
- 14
- 485
- 0
Báo cáo khoa học: Identification and characterization of a nuclear receptor subfamily I member in the Platyhelminth Schistosoma mansoni (SmNR1) pot
Ngày tải lên :
07/03/2014, 11:20
... two-hybrid assays. (A) Yeast one hybrid
assay showing that SmNR1 contains an autonomous transactivation
function in A ⁄ B domain. Individual AH109 yeast colonies obtained
from an initial transformation ... DNA and drive transcription in a mammalian cell
reporter gene assay in in vivo results.
Experimental procedures
Parasites
The NMRI strain of S. mansoni was maintained in snails
(Biomphalaria ... splice site of
A
DNA binding domain
B Ligand binding domain
Fig. 1. Sequence alignment. (A) Alignment
of DNA binding domain (C domain) and its
C-terminal extension. (B) Alignment of ligand
binding...
- 16
- 542
- 0
Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot
Ngày tải lên :
07/03/2014, 16:20
...
CLAP_2:ATTAGTGCTATAGTTTGGGAAATATTTAGTCCTTGTTTTGTGTGATCTTATAAGATAATATTTGTAGTTTGTGCTTTTATATAATTTAGCTCATTGGATT 1730
*
CLAP_1:AA
GATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA ...
CLAP_2:AAGTCTGTCGTCAAAATGTTATGAACGTCTCTTGTCATAAAGAAAGAGAACCTCTCTTTTTAGTTTGGTTTAGATATTAAGGACAGATCCAAAATATTTG 1132
*
CLAP_1:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTA
AAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT 1300
CLAP_2:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTA
AAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT ...
CLAP_1:ATTCTCCTGGCATTAAAGATGGAATGGAGGGAACCACGATGCAAGGAAAGAGTCTCATATTTTCAATCAAAGATGGTGAGGTTATAATCAACAGCAAGAC 900
CLAP_2:ATTCTCCTGGCATTAAAGATGGAATGGAGGGAACCACGATGCAAGGAAAGAGTCTCATATTTTCAATCAAAGATGGTGAGGTTATAATCAACAGCAAGAC 832
S P G I...
- 12
- 772
- 0
Cách sử dụng (Something) is down to (a number of something) pdf
Ngày tải lên :
10/03/2014, 11:20
... me, Claire, and Maria - Hiện giờ chỉ còn t i, Claire và
Maria.
Lưu ý rằng khi sử dụng “down to” thường kèm “now”, ở đâu đó trong câu.
V i b i viết Daily English Speaking Lesson này, ... half a bag of rice” = “chúng t i giờ chỉ còn n a
bao gạo”.
Thông thường bạn n i về số lượng sự vật/ đồ vật bị giảm, nhưng bạn cũng có thể
liệt kê như:
Now it’s down to just me, Claire, and ... ty c a bạn v a gặp ph i chút rắc r i. Phần lớn nhân viên trong bộ phận c a
bạn đều bị sa th i. Và giờ chỉ có bạn, sếp c a bạn và 1 nhân viên n a. Bạn n i
chuyện v i bạn c a mình về tình huống...
- 6
- 702
- 2
Báo cáo khoa học: Esculentin-1b(1–18) – a membrane-active antimicrobial peptide that synergizes with antibiotics and modifies the expression level of a limited number of proteins in Escherichia coli doc
Ngày tải lên :
16/03/2014, 00:20
... Stella
3
,
Pierpaolo Aimola
4
, Donatella Barra
1
and Maria Luisa Mangoni
1
1 Istituto Pasteur-Fondazione Cenci Bolognetti, Dipartimento di Scienze Biochimiche, Azienda Ospedaliera S. Andrea, Universita
`
La ... action;
peptide–membrane interaction; proteomics
Correspondence
M. L. Mangoni, Unita
`
di Diagnostica
Molecolare Avanzata, II Facolta
`
di Medicina
e Chirurgia, Azienda Ospedaliera S. Andrea,
via di Grottarossa, ... Vergata, Rome, Italy
4 Dipartimento di Biologia di Base ed Applicata, Universita
`
de L’Aquila, Italy
Keywords
frog skin antimicrobial peptides;
Gram-negative bacteria; mode of action;
peptide–membrane...
- 18
- 494
- 0
Báo cáo khoa học: Trans-splicing of a mutated glycosylasparaginase mRNA sequence by a group I ribozyme deficient in hydrolysis pptx
Ngày tải lên :
23/03/2014, 13:20
... incubation at trans-splicing and RPA hybridization
conditions. Below; quantitation of RPA of trans-spliced GA mRNA generatedbyDiGIR2AGUandDiGIR2DP9.2 AGU. Comparative
quantitative data were collected ... RNA 1, undigested probe; RNA 2, trans-spliced GA mRNA; RNA 3, major GA band; RNA 4, major DiGIR2 AGU and
DiGIR2DP9.2 AGU band. Additional bands result from degradation of RNA during incubation ... vitro
transcription, splicing reactions and RT-PCR
analysis
PrecursorRNAsforcis-splicing analyses were transcribed
from T7 promoters off BamHI-linearized pDiGIR2,
pDiGIR2 AGU and pDiGIR2DP9.2 AGU plasmids.
[
35
S]CTP[aS]...
- 7
- 307
- 0
