hydration of c c double bonds through subsequent reduction

... polychlorination of methane Cl Cl + H Cl CH3–nCln CH3–nCln + Cl Cl 400 C Δ CH3Cl CH2Cl2 CHCl3 + HCl CCl4 Cl Cl H + CH3–nCln CH3–nCln+1 + Cl E Ea,1 Fig 1.20 Energy profile of the propagation steps of the ... + Cl Starting materials TS1 I1 Cl CH3 Cl TS2 400 C Δ CH3Cl + HCl Cl Cl CH3 H + CH3 Cl + Cl Fig 1.17 Mechanism for monochlorination of methane with Cl2 Products E +1 Cl2 + CH4 + Cl • Cl2 + • CH3 ... polychlorinations CH3Cl Æ CH2Cl2, CH2Cl2 Æ CHCl3, and CHCl3 Æ CCl4 of methane (n = 1–3 in the diagram), and of the monochlorination CH4 Æ CH3Cl (n = in the diagram) Cl2 + CH4–nCln + Cl • Cl2...

Ngày tải lên: 02/04/2014, 16:01

... 55440-1101 Specifications published here are current as of the date of publication of this document Because we are continuously improving our products, ADC reserves the right to change specifications ... prior notice At any time, you may verify product specifications by contacting our headquarters office in Minneapolis ADC Telecommunications, Inc views its patent portfolio as an important corporate ... life in terms of bandwidth demand Service providers may find themselves in the position of deciding which course of action is more prudent in the long run – reaching customers ahead of competitors...

Ngày tải lên: 10/12/2013, 17:15

... accord with those announced by the central bank? Since it is the long end of the yield curve that affects the economy, and therefore acts as a key transmission channel of monetary policy, it could ... Reserve Bank of Kansas City ——— 2006b “Forecasting with Small Macroeconomic VARs in the Presence of Instabilities.” Economic Research Paper No 06-9, Federal Reserve Bank of Kansas City Cukierman, ... Transparency.” In NBER International Seminar on Macroeconomics 2007 Chicago: University of Chicago Press Hellwig, C 2005 “Heterogeneous Information and the Welfare Effects of Public Information Disclosures.”...

Ngày tải lên: 17/02/2014, 03:20

... derived from CCR5, a chemokine receptor, which plays a crucial role in HIV infection In all of these catalytic antibodies, a catalytic triad composed of Asp, Ser, and His was always identified through ... Japan Science and Technology Agency (Creation of Bio-devices and Biosystems with Chemical and Biological Molecules for Medicinal Use) and Grants-in-Aid for Scienti c Research from the Ministry of ... gp41 molecule as 41S-2-L was [10,11] In some cases, a significant change in the immunological character of the heavy or light chain could occur, resulting in a different specificity from that of the...

Ngày tải lên: 07/03/2014, 21:20

... TAATGCTTCCATAACGCGTGGGAA; D132A: CGTTC CCATTGCGCGGCCATCGGC; D132H: TACCACCGT TCCCATATGGCGGCCATCGGCAAT; D132N: TACCAC D132S: CGTTCCCATATTGCGGCCATCGGCAAT; TAC CACGTTCCCATGGAGCGGCCATCGGCAAT; R188M: CGCTACCGCCATGTTACGATCGCG ... Enzyme Nucleotide Km (mM) kcat (s)1) kcat Km (s)1ặmM)1) Wild-type CMP dCMP UMP CMP dCMP UMP CMP dCMP UMP CMP dCMP UMP CMP dCMP UMP CMP dCMP UMP CMP dCMP UMP CMP dCMP UMP 0.035 0.094 0.93 2.5 3.5 ... CGCTACCGCCATGTTACGATCGCG For each mutagenesis, the whole sequence of the cmk gene was checked for the absence of any other mutation [26] Plasmid pHS210 and derivatives were introduced into the E coli...

Ngày tải lên: 16/03/2014, 10:20

... Scanning electron microscopy (SEM) images were obtained with a Cambridge Instruments Stereoscan 120 Transmission electron microscopy (TEM) studies were recorded on JEOL 100 CX II electron microscope ... anisotropic growth of the particles can be explained by the speci c adsorption of ions to particular crystal surface, therefore, inhibiting the growth of these faces by lowering their surface energy ... roles on the types of structure, morphology and size of particles constituting the product The details of the effect of sulfate on the formation of WO3 nanocrystal are not clear up to date However,...

Ngày tải lên: 19/03/2014, 16:47

Ngày tải lên: 20/03/2014, 22:20

... the conclusion of the play, Iago does successfully eliminate the one character representative of heaven, innocence, and honesty Yet "remains the censure of this hellish villian" (Act V, Scene ... divine, the grace of heaven" (Act II, Scene I), while Iago in contrast is described as hellish after his plot is uncovered Iago uses the other characters in the play to work specifically towards ... that he convinces him to consider getting rid of Desdemona and even suggests methods of killing her Iago, so proud of his accomplishments of underhandedness : Work on My med'cine works! Thus credulous...

Ngày tải lên: 21/03/2014, 22:48

... internal polar cavity in the vicinity of the conserved catalytic Asp This cavity contains two to three crystallographic water molecules In stark contrast, the Rossman fold of PMA1_NEUCR contains as ... Research Director of the ÔFonds National de la Recherche ScientifiqueÕ (Belgium) We ´ thank the ÔCommunaute Francaise de Belgique: Actions de Recherche ¸ ´ ConcerteesÕ for financial support REFERENCES ... producing only very minor displacements of the atomic coordinates Identification of internal cavities Internal cavities were identified from the atomic coordinates of the PMA1_NEUCR model, ATC1_RABIT...

Ngày tải lên: 23/03/2014, 21:20

... Borneo of H.M.S Dido, by CHAPTER VII CHAPTER VIII CHAPTER IX CHAPTER X CHAPTER XI CHAPTER XII CHAPTER XIII CHAPTER XIV CHAPTER XV CHAPTER XVI CHAPTER XVII CHAPTER XVIII CHAPTER XIX CHAPTER XX CHAPTER ... visitors. Council of war. Why side with the Rajah. Mode of constructing forts. State of enemy's and Rajah's forces. Conduct of the war 87 CHAPTER VIII 12 CHAPTER VIII Appearance of the country. ... is a rich clay loam The principal production at present is rice, of which considerable quantities are grown on the banks of the river, which accounts for the clearing of so many miles of the...

Ngày tải lên: 29/03/2014, 22:20

... (without stop codon), 5¢-CG AGCTC AAA GGG GAT TTC TTC TTC-3¢; mCherry forward SacI, 5¢-CGAGCTC ATG GTG AGC AAG GGC GAG-3¢; mCherry reverse XhoI, 5¢-CCGCTCGAG TTA CTT GTA CAG CTC GTC C- 3¢] FEBS Journal ... 5¢-CG GGATCCATGTTTAATAAAGTGA TTATGG-3¢; HpSSB full length reverse BamHI,5¢CG GG ATCCCTTCATCAATATTGATTTCAGG-3¢; HpSSBDC20 reverse BamHI, 5¢-CGGGATCCTCACTGTGCTTGTAA ATTCTC-3¢; SSB reverse SacI ... (1996) Coccoid forms of Helicobacter pylori J Infect Dis 173, 1288 Chan WY, Hui PK, Leung K, Chow J, Kwok F & Ng CS (1994) Coccoid forms of Helicobacter pylori in the human stomach Am J Clin Pathol...

Ngày tải lên: 30/03/2014, 02:20

... Department of Electrical Engineering, COMSATS Institute of IT, Attock Campus, Attock, Pakistan 2Department of Electronics Engineering, Aligarh Muslim University, Aligarh, India 3School of Computer Science ... video codecs, the source code of H.264/AVC encoder is modified such that switching frames can be inserted at any desired location In this section, the behavior of the “downstairs” scheme is analyzed ... necessary to follow the rest of the article 2.1 Review of monotonically decreasing rate scheduler (downstairs) The basic philosophy of the “downstairs” reservation scheme is that certain characteristics...

Ngày tải lên: 20/06/2014, 22:20

... most common technique involved the use of triple contrast (oral, rectal, and IV) Patients were initially prepped with l of oral and 300 cc of rectal contrast (Bracco Diagnostics Inc., Princeton, ... referral of adult patients with clinical suspicion of acute appendicitis to color Doppler US and selected referral to CT based on US results and clinical judgment improved diagnostic accuracy and ... studies of the accuracy of CT and US in the diagnosis of acute appendicitis in adults and adolescent patients, including four studies directly comparing the two, showed that CT was superior to US CT...

Ngày tải lên: 20/06/2014, 23:20

... Processing (a) (b) (c) (d) (e) (f) Figure 3: First frame of each 4CIF test sequence: (a) Crowdrun, (b) DucksTakeOff, (c) Harbour, (d) Ice, (e) Parkjoy, and (f) Soccer Table 3: Specifications of LCD ... (CABAC) for coding efficiency Each frame was divided into a fixed number of slices, where each slice consisted of a full row of macroblocks The rate control was disabled, as it introduced visible ... deviation Sc ; (b) set Ps equal to the number of times the score of one subject if above mc + ωSc ; (c) set Qs equal to the number of times the score of one subject if below mc − ωSc ; (4) compute...

Ngày tải lên: 21/06/2014, 07:20

... inequality of H G Hardy since 1918 We also obtain new results involving fractional derivatives of Canavati and Caputo types as well as fractional integrals of a function with respect to another function ... valuable advice improved the final version of this paper The research of the second and third authors was supported by the Croatian Ministry of Science, Education and Sports, under the Research Grant ... 15 Notice that Hadamard fractional integrals of order α are special case of the left- and right-sided fractional integrals of a function f with respect to another function g x log x in a, b ,...

Ngày tải lên: 21/06/2014, 07:20

... such as motion compensation, transform coding of coefficients, and entropy coding VCL generates the encoded video slices, which are a collection of coded macroblocks (MBs) [1, 4] These coded slices ... that works on top of DCF [2] Using the services of DCF, HCF offers two access mechanisms: EDCA (enhanced distributed channel access) which is an enhanced version of the DCF of the original standard ... for contention-based access, and HCCA (HCF controlled channel access) that specifies the polling or controlled access schemes The 802.11e standard defines different tra c priorities in access categories...

Ngày tải lên: 21/06/2014, 23:20

... density functional calculations of surfaces and interfaces play a critical role in providing a nanoscopic understanding of the chemical bonding in these systems in the determination of the atomic geometry ... the reconstruction of Si surface electronic structures induced by H To depict the charge redistribution associated with the H adsorption on Si(111)-7 surface in real space, we first calculate ... unreactive, which will lead to the different surface kinetics and energetics between clean and H-terminated Si(111)-7 surface Calculation Method and Substrate Structures First-principles calculations...

Ngày tải lên: 22/06/2014, 00:20

... μq of the ordinary p-adic invariant measure He gave a different proof of complete sums of products of higher order q-Bernoulli polynomials In 21 , Jang et al gave complete sums of products of ... Journal of Inequalities and Applications valuation of Cp with |p|p p−vp p p−1 Here, q is variously considered as an indeterminate, a complex number q ∈ C, or p-adic number q ∈ Cp If q ∈ Cp , then ... polynomials associated with basic q − lfunctions,” Journal of Mathematical Analysis and Applications, vol 336, no 1, pp 738–744, 2007 13 T Kim, “Sums of products of q-Bernoulli numbers,” Archiv der...

Ngày tải lên: 22/06/2014, 18:20

... encoded macroblocks To overcome this problem, macroblocks are not coded as single units, but in larger groups of macroblocks, termed slices Slices are structures of jointly encoded macroblocks ... importance of each slice group and allocates more RS packets (RS slices) to slice groups car- Nikolaos Thomos et al Packet Packet Ki Packet Packet Ki + ··· Packet Ki + Ni ··· Source packets RS packets ... between successive classes (6) Compare the expected distortion of the ancestor classification with the lowest average distortion of all descendant classifications of step (3) If a classification with...

Ngày tải lên: 22/06/2014, 23:20

Ngày tải lên: 05/08/2014, 10:20