... 1991a; Ling et al., 2000), and to produce toxins and enzymes such as hemolysins (Hirono et al., 1997), catalases (Srinivasa Rao et al., 2003b) and dermatotoxins (Ullah and Arai, 1983b) for disseminating ... serious and the mortality rates may reach up to 50% as reported by Janda and Abott (1993a) Some of the clinical symptoms of gastroenteritis caused by this pathogen are acute secretory enteritis, and ... abilities to resist serum (Janda et al., 1991b; Ling et al., 2000) and phagocyte-mediated killings (Srinivasa Rao et al., 2001), to adhere to, invade and replicate within epithelial cells (Janda et...
Ngày tải lên: 15/09/2015, 17:11
... Milestone Contents Microorganisms containing recombinant DNA were prohibited outside of the laboratory Specified handling and construction processes Vectors that sexually move to “unsafe” ... Subsequent modifications 1986 expanded to include animals and plants, and biosafety levels 1994 officially relinquished control of GMO plants in the environment to EPA and APHIS The First “Safe” ... Difficult to work with Slow grower Poor receptor for transformation In the 1970’s and 1980’s The first cloning vectors such as pSC101 had limited functionality The next trend was to develop...
Ngày tải lên: 13/03/2014, 18:46
Báo cáo Y học: Structural analysis of deacylated lipopolysaccharide of Escherichia coli strains 2513 (R4 core-type) and F653 (R3 core-type) pot
... shown by HMQC to be linked to protons A1 (a-GlcpN), B4 (b-GlcpN), E4 (L,D-Hepp I) and F4 (L,DHepp II) The substitution with phosphate led to significant downfield shifts of protons and carbons at ... strain E coli J-5 [13] In addition, interresidual NOEs were observed from I1 to G3, M1 to I3, K1 to I1 and I2, and L1 to K1 and K2 establishing the sequence of these residues as a-D-Glcp1 fi 2-a-DGlcp1 ... 10 signals of anomeric protons and two pairs of signals originating from 3-deoxy protons characteristic of aKdop The assignment of H and 13C-resonances (Tables and 3) and determination of vicinal...
Ngày tải lên: 08/03/2014, 09:20
Maltose and maltotriose transport into ale and lager brewer´s yeast strains docx
... capacity has been shown to be the rate-limiting factor for maltose and maltotriose utilization The aim of the present study was to find novel ways to improve maltose and maltotriose utilization ... 21 1.5 Factors affecting maltose and maltotriose uptake efficiency 25 1.6 Kinetics of maltose and maltotriose transport 27 1.7 Maltose and maltotriose transporters ... between ale and lager strains Ale strains are suggested to be more hydrophobic and because of this more able to adhere to CO2 bubbles and to form yeast heads at the top of the fermentor (Dengis...
Ngày tải lên: 24/03/2014, 04:20
Báo cáo hóa học: " In vitro permissivity of bovine cells for wild-type and vaccinal myxoma virus strains" potx
... analyses JLD, AA and JG performed electron microscopy studies GF contributed to PBMC infection studies GF and SB coordinated the research BP and SB wrote the manuscript All authors read and approved ... infection (P2 and P3) Titers were determined by serial dilution-titration on RK13 cells The values correspond to a mean of at least two independent experiments Error bars correspond to the standard ... Amersham) and centrifugated at 900 g for 20 minutes PBMC were then harvested, washed in PBS, recovered by centrifugation at 870 g for 10 minutes and cultured To detect infected cells by flow cytometry,...
Ngày tải lên: 20/06/2014, 01:20
Báo cáo hóa học: " Nucleotide mismatches between the VP7 gene and the primer are associated with genotyping failure of a specific lineage from G1 rotavirus strains" potx
... lineage III (blue) and lineage IV (red) lected to understand this complex epidemiology [15] However, in recent years it was reported that the accumulation of point mutations in VP4 and VP7 genes was ... and one for P-typing [25] In the one developed by Gouvea et al [24], it was reported failures in the correct genotyping of G2, G8, G9 and G10 rotavirus strains [7,12,17,20,21], and In order to ... South Africa from 1984 to 1998 J Med Virol 2004, 72:320-327 Santos N, Hoshino Y: Global distribution of rotavirus serotypes/genotypes and its implication for the development and implementation of...
Ngày tải lên: 20/06/2014, 01:20
Screening of Bacillus strains as potential probiotics and subsequent confirmation of the in vivo effectiveness of Bacillus subtilis MA139 in pigs doc
... (5.0%) and wheat bran (1.5%) The diet was formulated to provide 3.26 Mcal/kg metabolizable energy (ME), 123 142 19.82% crude protein, and 1.23% lysine Sufficient vitamins and minerals were added to ... strains the tolerance of spores to unfavorable conditions was different from each other and that the tolerance test to simulated gut environments was therefore an effective method with which to screen ... plus 1.5% agar) in Petri dishes and grown at 37°C for 24 h Individual colonies of bacteria that appeared to be distinct and to have grown from one cell were chosen to further detect their antimicrobial...
Ngày tải lên: 07/07/2014, 19:20
Probiotic Lactobacillus Strains: in vitro and in vivo Studies pot
... can be attributed to translocated lactobacilli Our results showed that the Lactobacillus strains LOCK 0900, LOCK 0908 and LOCK 0919 are able to withstand the gut conditions and to interact with ... belong to the genus Lactobacillus and, more precisely, to the group of closely related species including L casei, L rhamnosus and L paracasei The strains LOCK 0900 and LOCK 0908 exhibited 97 and ... were safe and affected significantly the cytokine profile toward anti-allergic response They did not translocate through the intestinal barrier to blood and internal organs (CFU of Lactobacillus...
Ngày tải lên: 07/07/2014, 19:20
Báo cáo khoa học: "Capsular polysaccharide typing of domestic mastitis-causing Staphylococcus aureus strains and its potential exploration of bovine mastitis vaccine developmen" docx
... Streaming colonies were considered to be capsulated and compact growth was deemed to represent non-capsulate organism [11] Autoagglutination and salt aggregation test (SAT) To simulate growth conditions ... supernatants, 30 isolates were randomly selected and tested on the concentration of CP (Fig 4) It varied from to 3200 ng/ml for serotype CP, from to 8000 ng/ml for serotype CP, and to 6000 ng/ ml for serotype ... and developed in a freshly prepared substrate solution containing CN peroxidase substrate and 30% H2O2 peroxidase solution (Kirkegaard & Perry Laboratories, KPL, Maryland) The reaction was stopped...
Ngày tải lên: 07/08/2014, 14:23
Báo cáo khoa học: "Primary structure of mature SAG1 gene of an Indonesian Toxoplasma gondii and comparison with other strains" pps
... noitarutaned laitini :snoitidnoc gniwollof eht ta ,)ANDc ro AND cimoneg( xirtam fo stnuoma elbairav dna ,remirp hcae fo Mµ 4.0 ,reffub lµ 52 ni )ASU ,hcetoiB aicamrahP mahsremA ;oG-oT-ydaeR( sdaeb RCP ... dica-onima decuded ehT rebmun editoelcun sa nekat si ctt nodoc tsrif eht fo t tsrif ehT nevig si gnirebmun editoelcun eht dna snodoc sa detneserp si )wor rewol( ecneuqes editoelcuN 1-SI etalosi amsalpoxoT ... margorp eht gnisu yb sepotipe raenil nietorp fo noitamitse evitciderP PJA xilA secnerefeR nietorp eht fo noitcnuf eht ecneh ytirgetni larutcurts eht htiw erefretni ton od yeht esuaceb ylbaborp ,lavivrus...
Ngày tải lên: 07/08/2014, 18:21
Báo cáo sinh học: "Molecular epidemiology of clinical and carrier strains of methicillin resistant Staphylococcus aureus (MRSA) in the hospital settings of north India" pptx
... ecology of the human skin Adv Microb Ecol 1978, 2:245-489 Betley MJ, Borst DW, Regassa LB: Staphylococal enterotoxins, toxic shock syndrome toxin and streptococcal pyogenic exotoxins: a comparative ... to different classes of antibiotics, MRSA had been reported to acquire resistance to gentamicin and related aminoglycosides [30] therefore the treatment of infections due to these organisms and ... like hand washing and contact isolation and barrier nursing Intranasal 2% mupirocin applied twice daily for five days appears to be the most effective topical agent against MRSA [48-50] and eliminates...
Ngày tải lên: 08/08/2014, 19:20
Báo cáo sinh học: "n vitro activity effects of combinations of cephalothin, dicloxacillin, imipenem, vancomycin and amikacin against methicillin-resistant Staphylococcus spp. strains" pdf
... were >1 and < and antagonistic when values were ≥ 4.0 [18] Results and discussion Resistance in vitro was 88.44% to dicloxacillin, 80.7% to cephalothin, 69.23% to imipenem, and 100% to amikacin ... turbidities equivalent to that of a 0.5 McFarland standard were prepared to yield a final inoculums of × 105 to × 105 CFU/mL MICs were read after overnight incubation at 35°C Growth and sterility controls ... Mexican Hospital Arch Med Res 1999, 30:325-31 Santos Sanches I, Mato R, de Lencastre H, Tomasz A, CEM/NET Collaborators and the International Collaborators.: Patterns of multidrug resistance among...
Ngày tải lên: 08/08/2014, 19:20
Comparative genome and phenotypic analysis of Clostridium difficile 027 strains provides insight into the evolution of a hypervirulent bacterium" ppsx
... Comparison of phage island SMPI (Stoke Mandeville phage island) between C difficile strains 630, CD196 and R20291 Comparison of phage island SMPI (Stoke Mandeville phage island) between C difficile ... difference of the 027 toxin B gene sequence has yet to be investigated The PaLoc also includes toxin regulatory components, including tcdR, a sigma factor, and tcdC, a negative regulator that destabilizes ... continuing to evolve C difficile is known to produce two related glucosylating toxins, named toxin A and toxin B, which are encoded on the pathogenicity locus (PaLoc) [15] For some time, toxin production...
Ngày tải lên: 09/08/2014, 20:20
Báo cáo y học: "Pre-clinical development as microbicide of zinc tetra-ascorbo-camphorate, a novel terpenoid derivative: Potent in vitro inhibitory activity against both R5- and X4-tropic HIV-1 strains without significant in vivo mucosal toxicity" docx
... antimalarial and anti-inflammatory activities[7] BA and its derivatives have demonstrated high anti-HIV-1 activity and cytotoxicity against a variety of tumor cell lines comparable to some clinically ... not into macrophages and DC, and decreased dramatically DNA proviral quantity by to log10 into all primary cells tested, suggesting that its antiviral activity is mostly due to its capacity to inhibit ... excised and parts of the upper (cervicovagina), middle (midvagina), and lower (urovagina) areas of each vagina were fixed with formalin and paraffin embedded by standard histological examination To...
Ngày tải lên: 10/08/2014, 05:21
Báo cáo y học: " Comparative analysis of cell culture and prediction algorithms for phenotyping of genetically diverse HIV-1 strains from Cameroon" pps
... Research and Therapy 2009, 6:27 Findings Human Immunodeficiency virus type (HIV-1) enters the cell by a multistep process that involves CD4 binding and the use of co-receptors CCR5 or CXCR4 Co-receptor ... http://www.aidsrestherapy.com/content/6/1/27 ml) and AMD 3100 (100 ng/ml) to block CCR5 and CXCR4 Culture supernatants were harvested at days and and HIV replication was determined by measuring ... nested PCR and sequenced using primers ED31 5'CCTCAGCCATTACACAGGCCTGTCCAAAG and ES8 5'CACTTCTCCAATTGTCCCTCA and sequences were edited, aligned in Clustal program and translated into amino acids...
Ngày tải lên: 10/08/2014, 05:21
Báo cáo khoa hoc:" Comparison of nanoparticle-mediated transfection methods for DNA expression plasmids: efficiency and cytotoxicity" potx
... transfected into a mammalian cell line and the transfection efficiency and cytotoxicity of each protocol was analysed after transfection The addition of AuNPs (PLAL-AuNPs_S1 and _S2 and Plano-AuNPs) to ... (MIDGE) vectors and corresponding plasmids (containing coding sequences for eGFP or human IL-2) Here, the transfection efficiency was up to 36% (MIDGE Vectors) and 33% (plasmid vectors) respectively ... studies with different cell lines and expression vectors should be performed to be able to decide if the observed cytotoxic effects can be explained by simple NP cell intolerance or by incompatibility...
Ngày tải lên: 11/08/2014, 08:20
báo cáo khoa học: "Fatty acid profiles and their distribution patterns in microalgae: a comprehensive analysis of more than 2000 strains from the SAG culture collection" docx
... were cooled to RT and transferred with ml dichloromethane into a 12 ml glass tube and reextracted with ml hexane and ml water The hexane phase was dried under streaming nitrogen and redissolved ... performed the statistical analysis IF and TF conceived of the study, and participated in its design and coordination and helped to draft the manuscript All authors read and approved the final manuscript ... Latasa M, Reyes E: Lipid biomarkers and trophic linkages between phytoplankton, zooplankton and anchovy (Engraulis encrasicolus) larvae in the NW Mediterranean J Plankton Res 2006, 28:551-562 10 Schweder...
Ngày tải lên: 11/08/2014, 11:21
Báo cáo y học: " Antigenic analysis of classical swine fever virus E2 glycoprotein using pig antibodies identifies residues contributing to antigenic variation of the vaccine C-strain and group 2 strains circulating in China" ppt
... and replicated in ST cells in our laboratory These three viruses were propagated and titrated in ST cells Stocks were aliquoted and stored at -80°C until use The virus stocks were sequenced to ... normalizing to anti-his-tag binding first, and then to the wt C-strain rE2 protein binding to pig anti-C-strain and anti-QZ-07 sera, respectively Thus, the binding of the wt C-strain rE2 protein to either ... [22,23] and that mAbs 1E7 and 6B8 bind to conformational epitopes In addition, mAb 2B6 only bound to C-strain although its neutralization efficiency was low The conformational mAbs 1E7 and 6B8...
Ngày tải lên: 11/08/2014, 21:21
Báo cáo y học: "Genetic diversity and C2-like subgenogroup strains of enterovirus 71, Taiwan, 2008" pptx
... subgenogroup C4 strains in China from 1998 to 2008, C4b (from 1998 to 2004) and C4a (from 2003 to 2008), and the Shandong C4a strains were further divided into three lineages [26] In Taiwan, subgenogroup ... from 1998 to 2006 and in Germany from 1997 to 2007 [24,25] EV-71 of subgenogroup C5 was first isolated in southern Vietnam in 2005 and caused an outbreak with neurological disease and high prevalence ... several outbreaks took place in the USA, Japan, and other countries in the 1970s (subgenogroup B1), in Hong Kong, Australia, and the USA in the 1980s (subgenogroups B1, B2, and C1), and especially...
Ngày tải lên: 12/08/2014, 01:22
Báo cáo y học: " A multiplex reverse transcription-nested polymerase chain reaction for detection and differentiation of wild-type and vaccine strains of canine distemper virus" pptx
... Heilongjiang and Jilin province, CPV, CAV, CCV, RV, NDV, and uninfected cells three times to validate the repeatability of the test 30 samples in Heilongjiang and Jilin provinces, and Fifty-one ... grouped into wild-type viruses and belonged to a genotype that is obviously different from the CDV vaccine strain After the application of the first-round PCR, primers P2 and P4, and P3, P4, P5 and ... Complementary DNA and RNA probes have been used to detect RNA and mRNA of the CDV genome with improved specificity and sensitivity[6,7] Primers P1 and P4 (specific for CDV and conserved among...
Ngày tải lên: 12/08/2014, 04:20