human osteoclast culture and phenotypic characterization

Báo cáo y học: "Phenotypic and genotypic characterization of Human Immunodeficiency Virus type 1 CRF07_BC strains circulating in the Xinjiang Province of China" pot

Báo cáo y học: "Phenotypic and genotypic characterization of Human Immunodeficiency Virus type 1 CRF07_BC strains circulating in the Xinjiang Province of China" pot

... cultures were maintained for weeks in RPMI 1640 medium (Gibco) containing 20 U/ml of recombinant interleukin-2 (IL-2), 1% penicillin and streptomycin (P/S), mM glutamine and 10% FBS and the culture ... were washed and re-suspended in complete medium supplemented with recombinant interleukin-2 The cultures were maintained for three weeks and the culture media were changed twice a week Culture supernatants ... to and within the V1/V2 and the V3 loops of dualtropic human immunodeficiency virus type isolate DH12 gp120 affect co-receptor usage and cellular tropism J Virol 2001, 75:5998-6006 Simon V, Vanderhoeven...

Ngày tải lên: 12/08/2014, 23:21

10 599 0
Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx

Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx

... and biochemical characterization of human ACMSD Results Cloning of ACMSD transcripts The complete coding sequence of human ACMSD was obtained from reverse-transcribed human kidney Human ACMSD RNA, ... of the human enzyme was not regained upon removal of EDTA and addition of metal-ions Figure shows the hydrophobicity profiles of human and P fluorescens ACMSD, performed according to Kyte and Doolittle ... metal ligands for catalysis and share a conserved metal binding site, suggesting common aspects in their catalytic mechanism [21] From the sequence alignment of human and bacterial ACMSD and the...

Ngày tải lên: 19/02/2014, 02:20

14 601 0
Tài liệu Báo cáo khoa học: Structural and biochemical characterization of a human adenovirus 2/12 penton base chimera pptx

Tài liệu Báo cáo khoa học: Structural and biochemical characterization of a human adenovirus 2/12 penton base chimera pptx

... insertion of $ 230 residues (residues 133–367) between strands D and E and a smaller insertion of $ 50 residues (residues 404–458) between strands F and G The hypervariable loop, FEBS Journal 273 (2006) ... expression, the SF21 and Hi5 cell lines and the Bac-to-Bac expression system and vectors were from Invitrogen (Carlsbad, CA, USA) Protease inhibitors were from Roche (Basel, Switzerland) and Ni-NTA resin ... penton base (yellow), hAd2 ⁄ 12 (blue), and hAd2 fiber peptide complex (pink) The fiber peptide is drawn as ball -and- stick and colored by atom fiber peptide bound and unbound structures reveal a high...

Ngày tải lên: 19/02/2014, 06:20

10 648 0
Báo cáo Y học: Purification and biochemical characterization of some of the properties of recombinant human kynureninase pptx

Báo cáo Y học: Purification and biochemical characterization of some of the properties of recombinant human kynureninase pptx

... plotted using the CRICKETGRAPH and GraphPad PRISM3 software packages, and the kinetic parameters Km and Vmax were obtained using non-linear regression Lineweaver–Burk and Dixon [14] plots were used ... reducing agents SDS and mercaptoethanol to determine the native dimeric molecular mass resulted in the appearance of two bands at  52.5 and 95 kDa (gel image not shown), and this shows that ... This provides a relatively simple and economical method of producing active enzyme for use in mechanistic and structural studies Characterization of recombinant human kynureninase shows that it...

Ngày tải lên: 08/03/2014, 22:20

6 406 1
Báo cáo khoa học: Structural and functional characterization of human Iba proteins ppt

Báo cáo khoa học: Structural and functional characterization of human Iba proteins ppt

... We investigated Ca2+ binding and homodimerization of Iba1 and Iba2 Furthermore, F-actin binding and cross-linking assays were performed with both human Iba proteins, and their role in bacterial ... composed mainly of a helices (Figs and 2) The core of Iba2 is a pair of EF-hand motifs, denoted as EF-hands and 2, each consisting of two a helices (aA, aB and aC, aD, respectively) anking a ... Human Iba proteins J O Schulze et al study has revealed expression proles for most of the human transcripts and uncovered different tissuespecic expression of Iba1 and Iba2 [5] For...

Ngày tải lên: 16/03/2014, 06:20

14 546 0
Báo cáo khoa học: Crystal structure and solution characterization of the activation domain of human methionine synthase doc

Báo cáo khoa học: Crystal structure and solution characterization of the activation domain of human methionine synthase doc

... b2, b5 and b8) forms the upper part of the structure along with strands b3 and b4, which form a b meander On the opposite side of the sheets, after the meander, is a region of six a helices and ... residues Phe993 and Phe997 and the a3 and a6 helices Other hydrophobic residues involved include Trp982, Val1009, Tyr1121, and Ile1124 Part of this region is disordered in the human enzyme, with ... Human MS activation domain structure K R Wolthers et al A B Fig Stereoview of a superimposition of human and E coli MS activation domains (A) Overall structures: blue and green cartoons are human...

Ngày tải lên: 23/03/2014, 09:21

13 373 0
Báo cáo khoa học: Purification and functional characterization of human 11b hydroxylase expressed in Escherichia coli doc

Báo cáo khoa học: Purification and functional characterization of human 11b hydroxylase expressed in Escherichia coli doc

... to an anisotropy of the porphyrin absorption band [22] Upon addition of substrate, the signal of the positive CD band at 290 nm and the negative band at 386 nm decreased (Fig 4B) A similar observation ... surprising because the sequence identity between the human enzyme and the bovine enzyme is high (73%) However, some of the main differences between human and bovine CYP11B1 are located in FEBS Journal ... prerequisite for its future structural characterization Experimental procedures Protein expression and purification The human CYP11B1 was expressed as a mature form with N- and C-terminal modifications The...

Ngày tải lên: 30/03/2014, 04:20

12 428 0
Báo cáo nghiên cứu khoa học: " CHARACTERIZATION OF PROTEASE FROM ASPERGILLUS ORYZAE SURFACE CULTURE AND APPLICATION IN FISH SAUCE PROCESSING" pps

Báo cáo nghiên cứu khoa học: " CHARACTERIZATION OF PROTEASE FROM ASPERGILLUS ORYZAE SURFACE CULTURE AND APPLICATION IN FISH SAUCE PROCESSING" pps

... ninhydrin reagent RESULTS AND DISCUSSION Our prelimenary study shows that the optimal pH and temperature of the protease produced by Aspergillus oryzae surface culture are 7.0 and 50oC respectively ... was 65.45% and the purified degree was 3.03 This purified protease was used for determination of Km, Vmax and applied in fish sauce processing 2.3 Determination of kinetic parameters Km and Vmax ... conditions for protease extraction from A oryzae surface culture were as follows: solvent – phosphate buffer (pH = 6.5), ratio of surface culture and solvent – 1/8 (w/w), temperature – 20oC, time –...

Ngày tải lên: 22/07/2014, 10:21

6 459 1
Báo cáo y học: "Phenotypic and functional characterization of switch memory B cells from patients with oligoarticular juvenile idiopathic arthritis" pps

Báo cáo y học: "Phenotypic and functional characterization of switch memory B cells from patients with oligoarticular juvenile idiopathic arthritis" pps

... co-stimulatory molecules such as CD80 and CD86 and presenting antigens to T cells [9] With this background, we here address the immunophenotypic and functional characterization of synovial B cells ... chemokine receptor CXCR1, CXCR2, and CXCR3 mAbs from Serotec Inc (Raleigh, NC, USA); and PE-conjugated anti-CXCR4 and CXCR5 mAbs from R&D Systems Cell staining and flow-cytometric analysis were ... USA) After washing and blocking with PBS containing 1% BSA for 30 minutes, serial dilutions of cultured B cells were added and incubated overnight at 37°C Before plating, cultured B cells were...

Ngày tải lên: 09/08/2014, 14:22

12 448 0
Báo cáo y học: "Structural and functional characterization of human apolipoprotein E 72-166 peptides in both aqueous and lipid environments" pot

Báo cáo y học: "Structural and functional characterization of human apolipoprotein E 72-166 peptides in both aqueous and lipid environments" pot

... charge) Lanes and 5, human serum sample; lane and 6, apoE(-) mice serum sample; lane 3-4 and 7-9, apoE(-) mice serum incubated with full length apoE3 and apoE4, and with apoE2-, apoE3-, and apoE4-(72-166) ... by 0.73 in PBS and mM DHPC and by 0.86 in 50 and 100 mM DHPC (see materials and methods for detail) c, d, e Best-fit calculated sedimentation coefficients (s), molar mass (M), and local concentrations ... doi:10.1186/1423-0127-18-4 Cite this article as: Hsieh and Chou: Structural and functional characterization of human apolipoprotein E 72-166 peptides in both aqueous and lipid environments Journal of Biomedical...

Ngày tải lên: 10/08/2014, 05:21

9 333 0
báo cáo khoa học: "PVP-coated silver nanoparticles block the transmission of cell-free and cell-associated HIV-1 in human cervical culture" ppsx

báo cáo khoa học: "PVP-coated silver nanoparticles block the transmission of cell-free and cell-associated HIV-1 in human cervical culture" ppsx

... of the data, and in the writing and revision of this report L.I-T participated in designing the in vivo cervical tissue model and helped analyze and interpret the results H.H.L and L.I-T made ... Dezzutti CS: Preclinical testing of candidate topical microbicides for anti -human immunodeficiency virus type activity and tissue toxicity in a human cervical explant culture Antimicrob Agents Chemother ... supernatants from virulent cultures were used for viral inoculation MT-2 and H9+ cells were cultured in RPMI 1640 (Sigma-Aldrich), supplemented with 10% fetal calf serum (FCS) and antibiotics Commercially...

Ngày tải lên: 11/08/2014, 00:22

11 445 0
Báo cáo y học: "Characterization of human adenovirus 35 and derivation of complex vectors" doc

Báo cáo y học: "Characterization of human adenovirus 35 and derivation of complex vectors" doc

... primers CGTACCGTGTCAAAGTCTTC and CGAGTTCTCAATGATCGAGA using Taq polymerase and Expand High Fidelity PCR buffer (Roch Diagnostics, catalog # 1435094 and 11732641001) and 1.7 ul resolved on an agarose ... designed and carried out molecular genetic studies on viral genome modifications, participated in design and coordination of other studies, and helped to draft the manuscript MZ and DE designed and ... box, and E1A, E1B, and pIX coding sequences are represented (D) and (E) Northern blot analysis of transcripts in cells infected with wild type Ad35 (wt) or Ad35 viruses with E1 deletions and hybridized...

Ngày tải lên: 12/08/2014, 01:22

15 280 0
báo cáo khoa học: " Characterization and isolation of a T-DNA tagged banana promoter active during in vitro culture and low temperature stress" ppt

báo cáo khoa học: " Characterization and isolation of a T-DNA tagged banana promoter active during in vitro culture and low temperature stress" ppt

... designed and constructed the tagging vector and participated in sequence analysis SW maintained cell suspension and tissue cultures, subcultured and regenerated transgenic colonies and participated ... gene in lines 156, 49 and 111 In addition, T-DNA tandem repeats were identified in lines 156 and 49, and vector backbone sequences were integrated in lines 17, 156, 49 and 179 (data not shown) ... revisions and comments, and gave final approval to the manuscript LS conceived of the study, participated in its design, coordination and analysis, and finalised the manuscript All authors read and...

Ngày tải lên: 12/08/2014, 03:20

15 283 0
Characterization of CD137 ligand mediated human monocyte differentiation and their effects on t cell activities

Characterization of CD137 ligand mediated human monocyte differentiation and their effects on t cell activities

... CD95 ligand (CD95L), OX40 ligand (OX40L) and CD30 ligand (CD30L) Signals through these ligands have generally been described to be co-stimulatory to T cells This signalling through the ligand upon ... protein, antibodies and reagents 38 2.2 Protein immobilization on tissue culture plates 39 2.3 Cells and cell culture 40 2.3.1 Cell lines 40 2.3.2 Isolation of PBMCs, monocytes and T cells 40 2.3.3 ... signalling into the ligand bearing cell Hence, CD137 and its ligand participate in bidirectional signalling and stimulation of CD137L which results in signalling into ligand bearing cells has...

Ngày tải lên: 10/09/2015, 15:54

196 492 0
Design, structural and functional characterization of human beta defensin analogs

Design, structural and functional characterization of human beta defensin analogs

... from leukin, phagocytin and CAP molecules of rabbit and human were reported in 1985 (Selsted et al., 1985a and 1985b) and then recognized as natural peptide antibiotics and renamed as defensins ... carnosus, and many others It also has low lytic activity on the human erythrocytes and shows no cytotoxic effect against human cells The enormous number of investigations regarding the activity and ... straight lines and cysteine and mutated resides are underlined where rHBD-3 is devoid of any disulfide linkages (B) A 16.5% Tricine gel shows the expression level and purified bands of Def-A and rHBD-3;...

Ngày tải lên: 14/09/2015, 08:37

143 424 0
INTERLEUKIN 6 RELEASE FROM t98g HUMAN GLIAL CELL LINE AS a PREDICTIVE MARKER FOR CHRONIC PAIN, AND THE CHARACTERIZATION OF SUBSTANCE(S) INVOLVED IN PAIN

INTERLEUKIN 6 RELEASE FROM t98g HUMAN GLIAL CELL LINE AS a PREDICTIVE MARKER FOR CHRONIC PAIN, AND THE CHARACTERIZATION OF SUBSTANCE(S) INVOLVED IN PAIN

... markers and membrane proteins, and this triggers the production and release of painenhancing substances such as reactive oxygen species, excitatory amino acids, nitric oxide, prostaglandins and pro-inflammatory ... of cartilage and subchondral bone, leading to joint pain and other symptoms such as stiffness, tenderness and increase in intra-articular fluid (Conaghan, 2008) Knees, hips and hand joints are ... ligand for the orphan opioid-like receptor, and induces both hyperalgesia and allodynia when administered intrathecally in mice NST, on the other hand, blocks nociceptin-induced allodynia and...

Ngày tải lên: 02/10/2015, 17:15

136 601 0
Cambridge.University.Press.The.Crisis.of.Literature.in.the.1790s.Print.Culture.and.the.Public.Sphere.Nov.1999.pdf

Cambridge.University.Press.The.Crisis.of.Literature.in.the.1790s.Print.Culture.and.the.Public.Sphere.Nov.1999.pdf

... Pete, Guy, TerryBall, James, Andy, Mick, Opera-John, Mark and Sabine, and Tim and Melinda Tarik, Ben and Guy provided an unfailing supply of beds, couches, floors and backgammon within easy range ... the social and political constraints, and above all, the intense mutualities and struggles in social space that guide and block the passage of signs among historical writers, readers and audiences.5 ... poetry in England, and you will find it accompanied with literature [England’s poets] by their literature enriched their poetry; and what they borrowed from the public stock of art and science,...

Ngày tải lên: 21/09/2012, 11:00

316 973 2
Kogan.Page.Managing.Projects.in.Human.Resources.Training.and.Developement.Apr.2006.eBook-DDU.pdf

Kogan.Page.Managing.Projects.in.Human.Resources.Training.and.Developement.Apr.2006.eBook-DDU.pdf

... discusses an aspect of project management and includes examples drawn from HR, training and development settings Techniques are introduced and applied to examples, and there are ‘pauses for thought’ ... action and ensuring that the project team or teams can start work and understand what is needed The project manager needs also to consider how to secure personal support when it is needed and how ... training programme on data protection and confidentiality, which staff had found boring and not relevant to their own work A budget and timescale were agreed and a small team was formed to carry...

Ngày tải lên: 21/09/2012, 17:33

225 1,2K 6
Báo cáo y học: "Comparison of osteogenic potentials of human rat BMP4 and BMP6 gene therapy using [E1-] and [E1-,E2b-] adenoviral vectors"

Báo cáo y học: "Comparison of osteogenic potentials of human rat BMP4 and BMP6 gene therapy using [E1-] and [E1-,E2b-] adenoviral vectors"

... (Lanes 1, and 3), BstXI (Lanes 4, 5, and 6), and BglII plus EcoRV (Lanes 7, 8, and 9) M, 1-kb DNA ladder Lanes 1, 4, and 7, 293A cells; Lanes 2, 5, and 8, ADrBMP6 DNA; Lanes 3, 6, and 9, ADhBMP6 ... foreign human BMP, rat BMP4 and BMP6 cDNAs were amplified, cloned, sequenced, and identified Recombinant adenoviruses encoding rat BMP4 and BMP6 were constructed and compared with ADhBMP4 and ADhBMP6 ... antibody The staining differed from that of standard human BMP6, which was purchased from R&D Systems (Minneapolis, MN) and displayed two bands at 18 kD and 23 kD This difference may be due to dissimilar...

Ngày tải lên: 31/10/2012, 17:08

9 501 0
Some aspects of American culture and society in the twentieth and twenty-first centuries through a number of selected short literary works

Some aspects of American culture and society in the twentieth and twenty-first centuries through a number of selected short literary works

... concepts including culture and society, literature, short stories and other genres of literature, techniques in storytelling, and short literary works and their portrayal of culture and society Besides, ... customs, laws and etc make up a culture Culture and society are closely related We not have two different societies with exactly the same culture or one society with completely different culture Let ... memory with the sights and the people and in her time, she had learnt to respect their native states and their parents and everything else On the contrary, her children and grand children did not...

Ngày tải lên: 07/11/2012, 15:01

49 785 1
w