... buyer assumes that it is He assumes that the seller has some information about the car that he, the buyer, does not have—and the seller is punished for this assumed information And if the car is a ... measuring a contestant s actual votes against the votes that would truly best serve his self-interest, it s possible to tell if discrimination is at play The voting strategy changes as the game ... has become so unfashionable to discriminate against certain groups that all but the most insensitive people take pains to at least appear fair-minded, at least in public This hardly means that...
Ngày tải lên: 17/10/2013, 18:20
... car that travels faster, farther and wastes less energy The most common area where surface friction will occur is between the axle and the chassis The interface between the axle and the chassis ... chassis is called the bearing A plain bearing can be as simple as an axle turning in a drilled hole A bushing is a smooth sleeve placed in a hole that gives the axle a smother rubbing surface, ... the size and the shape of the craft A slow-moving boat or airplane encounters less friction than fast-moving boats or airplanes Wide boats and airplanes must push aside more fluid than narrower...
Ngày tải lên: 16/03/2014, 12:20
How to Write a Marketing PlanThe Marketing Plan is a highly detailed, heavily researched pdf
... The situational analysis covers six key areas: product, target market, distribution, competitors, financial and other issues Current Product Analysis (May be able to skip this section if plan is ... Pricing Distribution Other Areas Preferably this section includes a brief summary of current marketing decisions (see Situational Analysis) so readers of the plan can easily compare what was planned ... spreadsheet-style layout showing detailed breakdown of marketing revenues and expenses (Length: 2-4 pages) • Current Sales Analysis o Overall industry sales and market share (for at least the last...
Ngày tải lên: 22/03/2014, 14:20
How Is Deployment to Iraq and Afghanistan Affecting U.S. Service Members and Their Families potx
... workdays This is not to discount the possible role of specific dangers such as improvised explosive devices (IEDs), snipers, ambushes, and other hazards But available data sets not contain variables ... DoD formally regards it as “paramount to sustaining mission capabilities and mission readiness” (Office of the Assistant Secretary of Defense for Reserve Affairs, no date) but has no corresponding ... performance in the theater and later decisions about retention In this sense, DoD views family issues as critical to its ability to satisfy the military mission and inseparable from combat readiness...
Ngày tải lên: 23/03/2014, 08:20
Báo cáo khoa học: S -Stereoselective piperazine-2-tert-butylcarboxamide hydrolase from Pseudomonas azotoformans IAM 1603 is a novel L-amino acid amidase doc
... pSTB10 DNA sequence analysis An automatic plasmid isolation system PI-100 (Kurabo, Osaka, Japan) was used to prepare the double-stranded DNAs for sequencing The plasmid pSTB10 was used as a sequencing ... Kato, T., Sasamoto, S. , Watanabe, A. , Idesawa, K., Ishikawa, A. , Kawashima, K., Kimura, T., Kishida, Y., Kiyokawa, C., Kohara, M., Matsumoto, M., Matsuno, A. , Mochizuki, Y., Nakayama, S. , Nakazaki, ... amidase whose primary sequence is revealed Acknowledgements We are grateful to S Iwamoto, R Kasahara and A Nakayama (Toyama Prefectural University) for their technical assistance This work was supported...
Ngày tải lên: 23/03/2014, 12:20
Báo cáo khoa học: Human delta-lactoferrin is a transcription factor that enhances Skp1 (S-phase kinase-associated protein) gene expression pdf
... CCCAGTCCCATCCCAGAGGCCATCTCTGGTTTCTTCAGGG S: GTGCTGTTAGCCCTTATTTCCTACTATTAAAGAGGCTTCCATGCCAAACATAGCC F: GGCTATGTTTGGCATGGAAGCCTCTTTAAATAGTAGGAAATAAGGGCTAACAGCAC S: CTAGTGTCTGATGCTGCAACCACCGCCAC F: GTGGCGGTGGTTGCAGCATCAGACACTAG S: ... GTGTGGCAGGACGCTGCGCCTTTCACAG F: CTGTGAAAGGCGCAGCGTCCTGCCACAC S: TCCCAGAGGCACTGTACATCTCTG F: CAGAGATGTACAGTGCCTCTGGGA S: GCCTCTTTAGAAGTCAATAGTAGG F: CCTACTATTGACTTCTAAAGAGGC S: GCCTCTTTAGAAGATCAAAAGTAGG ... External S: GAGACTGGATAGGCTTGTAG External F: GCGCCGAGGACCCCG Internal S: ACAAAGACCTGGTAACTCA Internal F: GAACCTTACTCCACAATTAG S: CCCTGAAGAAACCAGAGATGGCCTCTGGGATGGGACTGGG F: CCCAGTCCCATCCCAGAGGCCATCTCTGGTTTCTTCAGGG...
Ngày tải lên: 30/03/2014, 08:20
Báo cáo khoa học: "How Many Words is a Picture Worth? Automatic Caption Generation for News Images" docx
... Unsurprisingly, the phrase-based system is significantly less grammatical than the gold standard and the extractive system, whereas the latter is perceived as equally grammatical as the gold standard ... that a probabilistic abstractive model defined over phrases yields promising results It generates captions that are more grammatical than a closely related word-based system and manages to capture ... Generating image captions is a challenging task even for humans, let alone computers Journalists are given explicit instructions on how to write captions4 and laypersons not always agree on what a...
Ngày tải lên: 30/03/2014, 21:20
How to read a person like a book
... things done He is a person who has a high enthusiasm for what he is attempting to achieve and may also have some of the qualities that Dr Abraham Maslow has described as "self-actualizing." It is ... situation As a result of this feeling, he clenches his hands, stares at his opposer, silhouettes his body, crosses his legs (all gestures of suspicion), yet still manages to say weakly, "I've an open ... in a superior/subordinate situation the subordinate is very suspicious of his superior 's attitude As long as his boss sits behind his desk and "looks down his nose at him," the subordinate 's hands...
Ngày tải lên: 12/04/2014, 00:29
how to read a person like a book
... Expressions Walking Gestures Shaking Hands OPENNESS, DEFENSIVENESS, EVALUATION, SUSPICION Openness Defensiveness Evaluation Suspicion and Secretiveness READINESS, REASSURANCE, COOPERATION, FRUSTRATION ... hands, stares at his opposer, silhouettes his body, crosses his legs (all gestures of suspicion), yet still manages to say weakly, “I’ve an open mind and want to settle this thing.” His opposer senses ... proposal Then if his head is shifted to the same level as yours, smile is relaxed and appears enthusiastic, the sale is virtually made We have discovered that many persons who acknowledge that...
Ngày tải lên: 12/06/2014, 17:15
báo cáo sinh học:" How labour intensive is a doctor-based delivery model for antiretroviral treatment (ART)? Evidence from an observational study in Siem Reap, Cambodia" potx
... lasted on average 15 minutes As the total time patients stay in this phase is very variable, and can last several years, an estimation of the number of visits was impossible During ART initiation, ... patient When a CD4 count reaches less than 200/μl, baseline laboratory parameters are taken, and the patient is further assessed till the decision is taken to start ART When a CD4 count is above ... highest HIV prevalence in Asia In 2003, adult HIV prevalence in Cambodia was assessed as 1.9%, with an estimated 123 000 PLWHAs This is a significant decrease from 1997, when HIV prevalence was...
Ngày tải lên: 18/06/2014, 17:20
Báo cáo hóa học: " The temperature arrested intermediate of virus-cell fusion is a functional step in HIV infection" ppt
... was added at the onset of TAS and not in the last hour of TAS This indicates that the step of sCD4 inhibition arises before TAS while the step of C34 inhibition arises after TAS has been established ... integrated provirus expresses the HIV protein tat, which in turn activates β-galactosidase expression Expression can then be readily detected in a liquid assay for β-galactosidase and read in a plate ... cells These cells stably express CD4 and CCR5 as well as endogenous levels of CXCR4 These cells also contain an expression cassette for β-galactosidase driven by an HIV LTR promoter If the cells...
Ngày tải lên: 20/06/2014, 01:20
How to Write a Marketing PlanThe Marketing Plan is a highly detailed, heavily researched docx
... The situational analysis covers six key areas: product, target market, distribution, competitors, financial and other issues Current Product Analysis (May be able to skip this section if plan is ... Pricing Distribution Other Areas Preferably this section includes a brief summary of current marketing decisions (see Situational Analysis) so readers of the plan can easily compare what was planned ... spreadsheet-style layout showing detailed breakdown of marketing revenues and expenses (Length: 2-4 pages) • Current Sales Analysis o Overall industry sales and market share (for at least the last...
Ngày tải lên: 28/06/2014, 12:20
This is a transcript of Warren Buffett''''s live interview on CNBC before appearing docx
... up steam And particular March, April, and May, it 's it 's it 's shown some acceleration So what 's happening in Europe has not had an effect here yet in— in terms of our businesses It 's it 's a ... (LAUGH) store still has to buy ads in the paper BECKY: Right, there are— are two proposals in congress that have gotten a lotta play One is from senate— is from Congressman Barney Frank who takes ... necessarily correlated with each other And — and that was — that was a fallacious model, it was held by Freddie Mac, Fannie Mae, the U .S Congress, the media, me, (LAUGH) investors, and— and home...
Ngày tải lên: 28/06/2014, 17:20
HOW TO READ A REPORT Management’s docx
... “Management s Discussion and Analysis” and “Audited Financial Statements.” It may also contain supplemental financial information In Management s Discussion and Analysis (MD &A) , a company s management ... Typical s financial status The statement of cash flows presents the changes in cash resulting from business activities Cash-flow analysis is necessary to make proper investing decisions and to maintain ... inventories by raw materials, work-inprocess, finished goods and supplies should be presented AND AUDIT REPORTS s Asset impairment—disclosure of details about impaired assets or assets to be disposed...
Ngày tải lên: 28/06/2014, 18:20
How to Write a Marketing PlanThe Marketing Plan is a highly detailed, heavily researched doc
... The situational analysis covers six key areas: product, target market, distribution, competitors, financial and other issues Current Product Analysis (May be able to skip this section if plan is ... Pricing Distribution Other Areas Preferably this section includes a brief summary of current marketing decisions (see Situational Analysis) so readers of the plan can easily compare what was planned ... spreadsheet-style layout showing detailed breakdown of marketing revenues and expenses (Length: 2-4 pages) • Current Sales Analysis o Overall industry sales and market share (for at least the last...
Ngày tải lên: 28/06/2014, 18:20
what is a firewall how firewalls works
... the data being passed does not match the state of the conversation (as defined by the state table), or if the data is not in the state table, it is dropped This process is known as stateful inspection ... Authenticate Access A common mistake that people make when evaluating firewalls is to consider packet inspection of the source IP address and port as being the same as authentication Sure, packet inspection ... protected resources After all, it is a relatively trivial task to spoof an IP address, making one host appear to be an entirely different host and thus defeating inspection based on source address and...
Ngày tải lên: 11/07/2014, 13:14
Let''''s face it -- English is a crazy language pps
... the same English? How can it be easier to assent than to dissent but harder to ascend than to descend? Why is it that a man with hair on his head has more hair than a man with hairs on his head; ... priceless ones? If appropriate and inappropriate remarks and passable and impassable mountain trails are opposites, why are flammable and inflammable materials, heritable and inheritable property, and ... does a freedom fighter fight? If a horsehair mat is made from the hair of horses, from what is a mohair coat made? A slim chance and a fat chance are the same, as are a caregiver and a caretaker,...
Ngày tải lên: 12/07/2014, 15:20
HOW IS CUSHING''''S SYNDROME DIAGNOSES? pptx
... improvements in physical changes and the combination of Cushing 's and adrenal insufficiency signs and symptoms (dizziness, weakness, nausea, loss of appetite) as replacement steroid hormones are tapered ... ENDOCRINOLOGIST? Iatrogenic Cushing 's Syndrome is generally managed by the physician prescribing the steroid hormones for the primary illness, such as asthma, arthritis, or inflammatory bowel disease Sometimes ... steroid hormone replacement therapies Surgical cure of the primary cause of the Cushing 's Syndrome is always the best, if possible HOW NORMAL IS A CUSHING 'S PATIENT 'S LIFE? The symptoms, disabilities...
Ngày tải lên: 29/07/2014, 02:21
Báo cáo toán học: "How frequently is a system of 2-linear Boolean equations solvable" ppsx
... [8] this exponential smallness was established for the conditional probability, given that the random graph has a giant component Here is a technical reason why, for λ = O(1) at least, the asymptotic ... grow essentially as r r , too fast for Fr (x) = Fr∞ (x) to be useful for asymptotic estimates The next Lemma L L (last in this subsection) shows that, in a pleasing contrast, fr , gr grow much slower ... Daud´ and V Ravelomanana, Random 2-XORSAT at the satisfiability threshold, e LATIN 2008: Theoretical Informatics, 8th Latin American Symposium Proceedings, (2008) 12-23 [11] O Dubois and J Mandler,...
Ngày tải lên: 08/08/2014, 12:22