... basis of the phosphate released by alkaline phosphatase treatment The absorbance spectrum of the nucleotide is shown in Fig 3A in comparison to those of NADP+ and NADPH A peculiar feature of the ... as catalyzed by FprA and AdR Figure 4A shows the time courses of NADP+ oxidation to NADPO catalyzed by FprA or AdR in the presence of air oxygen Clearly, both enzymes are able to catalyze this ... than that of FprA under the same conditions A peculiar feature of the NADP+ oxidation kinetics is the progressive decrease in the reaction rate When FprA was the catalyst, this behavior was particularly...
Ngày tải lên: 16/03/2014, 11:20
... ballistic missile defense The AN/TPY-2 is capable of tracking all classes of ballistic missiles and identifying small objects at long distances This radar in the forward-based mode acts as advanced ... supportable BMD capability on Aegis cruisers and destroyers The Aegis BMD builds upon the existing Navy Aegis Weapons System (AWS) and Standard Missile-3 (SM-3) capabilities The Aegis BMD upgrades ... been established in Colorado and Alaska DoD Missile Defense Agency Photo Mission: Provides the Combatant Commanders the capability to defend the United States, including Hawaii and Alaska, against...
Ngày tải lên: 20/02/2014, 05:21
OFFICE OF THE UNDER SECRETARY OF DEFENSE (COMPTROLLER) / CHIEF FINANCIAL OFFICER pptx
... C-130 Avionics Modernization Program (AMP) Termination The C-130 AMP was designed to meet Federal Aviation Administration (FAA) and European Air Traffic and Management Navigation and Safety mandates, ... toward a more analytic orientation and to ensure the financial management workforce has the knowledge, skills, and abilities necessary to achieve auditable financial statements The DoD Financial ... certify financial management personnel (civilian and military) Specifically, OUSD(C) established the DoD Financial Management Certification Program that aims to move the entire financial management...
Ngày tải lên: 23/03/2014, 02:20
Báo cáo Y học: Bass hepcidin is a novel antimicrobial peptide induced by bacterial challenge pptx
... 3¢) The organization of the peptide domains (signal peptide, prodomain, and mature peptide) is shown by amino-acid sequence enclosed by a underlined bar The stop codon is indicated by an asterisk ... and a Ôpoly A headÕ was created following incubation with dATP and terminal deoxynucleotide transferase (Stratagene) The cDNA with the polyA head was amplified with the primer pair, 219R and poly ... two additional analytical RP/HPLC purification steps as confirmed by capillary zone electrophoresis (data not shown) MALDI-TOF MS analysis of both fractions revealed the presence of an identical...
Ngày tải lên: 24/03/2014, 03:21
Báo cáo khoa học: The phosphatidylethanolamine level of yeast mitochondria is affected by the mitochondrial components Oxa1p and Yme1p ppt
... GTTCACGTACAAGCGGAGCCACAGAATAACCTCCCCGACGCGGATCCCCGGGTTAATTAA GTTTTATATTTTTATATTTACAGAGAGATATAGAGCCTTTATGAATTCGAGCTCGTTTAAAC GCCAGTTAAGAACGCCTTGGCGCAAGGGAGGACGCTCCTCCGGATCCCCGGGTTAATTAA CAGGTATGTGGTTCCAAGTGTTTGTCGCTCTTTGAATTTGGAATTCGAGCTCGTTTAAAC ... CAGGTATGTGGTTCCAAGTGTTTGTCGCTCTTTGAATTTGGAATTCGAGCTCGTTTAAAC TCTAATACGACTCACTATAGGGAGAATGTCAATTATGCCAGTTAAG CTTTACATATGATTGCTTTCATTTTAAATCATTCTTTCC AGAACTGCGGTGCTATGGAATAGA TTTGGCACGATCCACAATCTC an overnight culture and cells ... functional Oxa1p is missing the membrane subunits of these complexes cannot be assembled and are cleaved by the intermembrane space (i)-AAA protease Yme1p and ⁄ or by the matrix (m)AAA protease Afg3p...
Ngày tải lên: 30/03/2014, 04:20
Báo cáo sinh học: " High Chromosome Number in hematological cancer cell lines is a Negative Predictor of Response to the inhibition of Aurora B and C by GSK1070916" potx
... primary blasts Haematologica 2008, 93:662-669 34 Sharma SV, Haber DA, Settleman J: Cell line-based platforms to evaluate the therapeutic efficacy of candidate anticancer agents Nat Rev Cancer ... Ikezoe T, Yang J, Nishioka C, Tasaka T, Taniguchi A, Kuwayama Y, Komatsu N, Bandobashi K, Togitani K, Koeffler HP, Taguchi H: A novel treatment strategy targeting Aurora kinases in acute myelogenous ... normalized to a value of 150 using the mas5 algorithm in the Affymetrix Microarray Analysis Suite 5.0 For subsequent analysis, the average probe intensity was used for triplicates Values of mRNA...
Ngày tải lên: 18/06/2014, 22:20
o cáo hóa học:" High Chromosome Number in hematological cancer cell lines is a Negative Predictor of Response to the inhibition of Aurora B and C by GSK1070916" ppt
... primary blasts Haematologica 2008, 93:662-669 34 Sharma SV, Haber DA, Settleman J: Cell line-based platforms to evaluate the therapeutic efficacy of candidate anticancer agents Nat Rev Cancer ... Ikezoe T, Yang J, Nishioka C, Tasaka T, Taniguchi A, Kuwayama Y, Komatsu N, Bandobashi K, Togitani K, Koeffler HP, Taguchi H: A novel treatment strategy targeting Aurora kinases in acute myelogenous ... normalized to a value of 150 using the mas5 algorithm in the Affymetrix Microarray Analysis Suite 5.0 For subsequent analysis, the average probe intensity was used for triplicates Values of mRNA...
Ngày tải lên: 20/06/2014, 04:20
baml pan european building conference 2011 thomas aebischer chief financial officer john m feigl investor relations officer october 11th 2011 holcim ltd
... still rock-solid and dynamic! Largest construction markets (global ranking) 2009 USA China Japan Germany Spain France Italy South Korea India UK Canada Brazil Australia Russia Indonesia Mexico 2010 ... Diversification Local Management Global Standards • GDP growth • Management and • Favourable demographics manpower resources • Resource management • Deficit markets • Substantial market share • Local ... North America 21.3% 7.7% • Supported by global standards Policies & directives Exchange of know how & 38.9% best practices / benchmarking Latin America Africa Middle East Asia Pacific …the...
Ngày tải lên: 30/07/2014, 21:29
Báo cáo y học: "LV reverse remodeling imparted by aortic valve replacement for severe aortic stenosis; is it durable? A cardiovascular MRI study sponsored by the American Heart Association" pot
... principal study RW performed the CMR exams and data analysis JY performed the CMR exams and data analysis DV statistical analysis VR helped interpret CMR exams served as the second cardiologist on the ... study GR assisted in primary data analysis and was the software engineer for the study KC participated in the study as the cardiology fellow and separately analyzed mitral regurgitation data MD helped ... mean and peak transvalvular gradients, they were 53 and 78 mmHg, respectively; severe AS Page of variance (ANOVA) and repeated-measures ANOVA was performed for comparisons over time Statistical...
Ngày tải lên: 10/08/2014, 09:21
Báo cáo khoa học: Xenopus Rbm9 is a novel interactor of XGld2 in the cytoplasmic polyadenylation complex pptx
... mechanism underlying XRbm9-dependent translational activation is unclear and awaits further investigations The subcellular localization of mammalian Rbm9 is unclear and is dependent on the isoform ... interactor C Papin et al luciferase activity by MS2-XRbm9 These data suggest that the translational activation by tethered XRbm9 is not dependent on XGld2 This experiment also shows that the translational ... regulated mRNAs Although cytoplasmic polyadenylation is regulated by a protein complex at the 3¢-end of the mRNA, PAP is the only known enzyme capable of elongating the poly (A) tail This activity...
Ngày tải lên: 07/03/2014, 05:20
REPORT ON OBSERVATIONS OF PCAOB INSPECTORS RELATED TO AUDIT RISK AREAS AFFECTED BY THE ECONOMIC CRISIS pot
... Financial Accounting Standards Board and the International Accounting Standards Board, have embarked on an ambitious agenda to revise applicable accounting and financial reporting requirements The accounting ... evidential matter to afford a reasonable basis for an opinion regarding the financial statements under audit.27/ To audit fair value measurements or other estimates used by management, PCAOB standards ... preparation of their 2007 fiscal year-end financial statements 7/ Paragraphs 20 and 23 of AU sec 328, Auditing Fair Value Measurements and Disclosures, and paragraph 06 of AU sec 332, Auditing Derivative...
Ngày tải lên: 23/03/2014, 02:20
Báo cáo khoa học: "The Manually Annotated Sub-Corpus: A Community Resource For and By the People" potx
... Event Coreference Method Validated Validated Validated Validated Validated Validated Manual Validated Manual Validated Validated Manual Validated Manual Manual Manual No texts 118 118 118 118 ... appropriate metadata together with machine-processable information about associated annotations and interrelations among the annotation layers; and (2) a segmentation of the primary data into minimal ... MASC data and annotations into NLTK14 Because the GrAF format is isomorphic to input to many graph-analytic tools, existing graphanalytic software can also be exploited to search and manipulate...
Ngày tải lên: 30/03/2014, 21:20
Checklist for Review of Financial Audits Performed by the Office of Inspector General_part1 pptx
... conducting the audit in accordance with GAGAS Those standards require that the auditor obtain reasonable, rather than absolute, assurance about whether the financial This is trial version www.adultpdf.com ... qualitatively material to the financial statements, did the auditors apply audit procedures specifically directed to ascertain the potential effect on the financial statements or other financial data ... Did the auditor design the audit to provide reasonable assurance of detecting material misstatements resulting from illegal acts that could have a direct and material impact on the financial statements?...
Ngày tải lên: 19/06/2014, 15:20
Checklist for Review of Financial Audits Performed by the Office of Inspector General_part2 pot
... of the financial statements? (AU 560.03) • If the auditor became aware, subsequent to the report date, of information that may have existed at the report date and that might have affected the audit ... Not a significant audit area Accounts Receivables Not a significant audit area Other Receivables Not a significant audit area Stockpile Materials Not a significant audit area Property, Plant, and ... 10 Other Properties Not a significant audit area 11 Accounts Payable and Accrued Liabilities Not a significant audit area 12 Capital Leases Not a significant audit area 13 Pensions and Other...
Ngày tải lên: 19/06/2014, 15:20
APPENDIX C: CHECKLIST FOR REVIEW OF FINANCIAL AUDITS PERFORMED BY THE OFFICE OF INSPECTOR GENERAL pptx
... contracts or grant agreements that could have a material effect on the financial statements or other financial data significant to the audit? • Instances of abuse that could have a quantitatively ... previously-issued financial statements are misstated and (2) the misstatement is or reasonably could be material to the financial statements? (GAS, 5.27) 3.6.3 When previously-issued financial This is ... in accordance with GAAS and an identification of the United States as the country of origin of those standards, and with the standards applicable to financial audits contained in GAGAS issued by...
Ngày tải lên: 19/06/2014, 15:20
Peer Review Training – National Science Foundation August 1, 2011 Appendix C - Checklist for Review of Financial Audits Performed by the OIG potx
... Conclusion The adequacy of the OIG’s policies and procedures are evaluated in Appendix A If reviewer concludes that the financial audit met professional standards, but… inadequate policies and procedures ... Appendix B Staffing – Experienced financial statement auditors This is trial version www.adultpdf.com Fieldwork Standards AICPA GAGAS Planning & Supervision Internal Controls Sufficient Appropriate ... Appropriate Audit Evidence Communication Prior Reports Material Misstatements Findings Elements (C3E) Audit Documentation This is trial version www.adultpdf.com Reporting Standards AICPA GAGAS...
Ngày tải lên: 19/06/2014, 15:20
Checklist for Review of Financial Audits Performed by the OIG_part1 potx
... organization accomplish its objectives by bringing a systematic, disciplined approach to evaluate and improve the effectiveness of risk management, control, and governance processes This is trial ... The internal auditor is responsible to management The external auditor is responsible to financial statement users This is trial version www.adultpdf.com ©2008 Prentice Hall Business Publishing, ... literature for performance of government audits is Government Auditing Standards, which is issued by the GAO Because of the color of the cover, it is usually referred to as the “Yellow Book.” This...
Ngày tải lên: 20/06/2014, 06:20
Checklist for Review of Financial Audits Performed by the OIG_part2 doc
... complied with the laws, regulations, and the provisions of contracts or grant agreements that may have a direct and material effect on each of its major programs This is trial version www.adultpdf.com ... whether the schedule of federal awards is presented fairly in all material respects in relation to the financial statements as a whole This is trial version www.adultpdf.com ©2008 Prentice Hall Business ... Hall Business Publishing, Auditing 12/e, Arens/Beasley/Elder 26 - 15 Reporting Requirements An opinion on whether the financial statements are in accordance with GAAP An opinion as to whether...
Ngày tải lên: 20/06/2014, 06:20
Checklist for Review of Financial Audits Performed by the OIG_part3 pdf
... materials are not available when needed An assembly line was shut down for lack of materials A duplication of effort by employees exists Production and accounting keep identical records This is ... Compliance with applicable laws and regulations This is trial version www.adultpdf.com ©2008 Prentice Hall Business Publishing, Auditing 12/e, Arens/Beasley/Elder 26 - 25 Types of Operational Audits ... Functional Organizational Special assignments This is trial version www.adultpdf.com ©2008 Prentice Hall Business Publishing, Auditing 12/e, Arens/Beasley/Elder 26 - 26 Who Performs Operational Audits...
Ngày tải lên: 20/06/2014, 06:20