... Myoepithelial cell staining patterns of papillary breast lesions: from intraductal papillomas to invasive papillary carcinomas Am J Clin Pathol 2005, 123:36-44 Ganesan S, Karthik G, Joshi M, Damodaran ... JL: Intracystic papillary carcinoma in the male breast Breast J 2003, 9:249-250 Blaumeiser B, Tjalma WA, Verslegers I, De Schepper AM, Buytaert P: Invasive papillary carcinoma of the male breast ... swelling in his left breast He also had a significant family history for breast cancer including a maternal grandmother, two of his maternal aunts and a maternal first cousin diagnosed with breast...
Ngày tải lên: 11/08/2014, 19:21
... osteoarthritis (Sethuraman et al., 2007) Amino acids including aspartate, arginine, asparagine, tyrosine and valine were also demonstrated to be elevated in the CSF of chronic pain patients as ... function in sustaining the pain (Vallejo et al., 2010) An interesting finding was that nerve injury induces an increase in interleukin-18 (IL-18) and IL-18 receptors in activated microglia and astrocytes ... chronic pain Amino acids and prostaglandins are two such examples 1.2.1.1 Amino Acids Glutamate is the main excitatory amino acid in the mammalian CNS Its interaction with glutamate receptors mediates...
Ngày tải lên: 02/10/2015, 17:15
Báo cáo khoa học: "Mid-regional pro-adrenomedullin as a prognostic marker in sepsis: an observational study" pot
... done in a blinded manner as a batch analysis MR-proADM was detected in EDTA plasma of all patients using a new sandwich immunoassay (B.R .A. H.M.S Sevadil® LIA; B.R .A. H.M.S., AG, Hennigsdorf/Berlin, ... Minamino N, Kubo A, Akai Y, Kangawa K, Matsuo H, Fujimura Y, Yoshioka A, Masui K, et al.: Increased plasma levels of adrenomedullin in patients with systemic inflammatory response syndrome Am ... Myocardial infarction 12 Heart failure 11 Pulmonary embolism Haemorrhagic shock Abdominal 24 Gastrointestinal bleeding Abdominal infection Urinary tract infection Acute renal failure Hepatic coma Cerebral...
Ngày tải lên: 12/08/2014, 23:20
Delayed presentation in breast cancer: a study in Iranian women docx
... operable breast cancer patients Eur J Cancer Prev 2001, 10:53-59 Ebrahimi M, Vahdaninia M and Montazeri A: Risk factors for breast cancer in Iran: a case-control study Breast Cancer Research 2002, ... Iran social values and moral considerations limit the use of mass media for publicizing breast cancer awareness Breast cancer is not taboo but because the breast is regarded as part of female ... www-dep.iarc.fr/globocan/globocan.html] Jarvandi S, Montazeri A, Harirchi I and Kazemnejad A: Beliefs and behaviours of Iranian teachers toward early detection of breast cancer and breast self-examination...
Ngày tải lên: 28/03/2014, 14:20
Báo cáo sinh học: "Glutamate carboxypeptidase activity in human skin biopsies as a pharmacodynamic marker for clinical studies" docx
... tissue samples easily assessable in human subjects Abbreviations GCP: glutamate carboxypeptidase; NAAG: N-acetyl-aspartyl-glutamate; NAA: N-acetyl-aspartate; CSF: cerebrospinal fluid; CNS: central ... Page of Chromatographic analysis was performed using a Waters ACQUITY UPLC (Milford, MA, USA) Separation of the analytes from potentially interfering material was achieved at ambient temperature ... Neale JH: Local administration of Nacetylaspartylglutamate (NAAG) peptidase inhibitors is analgesic in peripheral pain in rats Eur J Neurosci 2007, 25:147-158 22 Cangro CB, Namboodiri MA, Sklar...
Ngày tải lên: 18/06/2014, 19:20
báo cáo hóa học: " Saliva soluble HLA as a potential marker of response to interferon-β1a in multiple sclerosis: A preliminary study" pdf
... was started by adding O-phenylenediamine as a substrate The color intensity is proportional to sHLA concentration Absorbance was measured at 492 nm Saliva levels of sHLA-II were measured at baseline ... Center in Shreveport and signed informed consent was obtained from all participants Measurement of soluble HLA A solid phase ELISA was used to quantitate s-HLA-I and sHLA-II in the saliva obtained ... associated with a decline on brain MRI activity as demonstrated by post-contrast T1-weighted axial brain images Initially, six patients had contrast enhancing lesions on axial post-contrast T1-weighted...
Ngày tải lên: 19/06/2014, 22:20
báo cáo hóa học:" Glutamate carboxypeptidase activity in human skin biopsies as a pharmacodynamic marker for clinical studies" doc
... tissue samples easily assessable in human subjects Abbreviations GCP: glutamate carboxypeptidase; NAAG: N-acetyl-aspartyl-glutamate; NAA: N-acetyl-aspartate; CSF: cerebrospinal fluid; CNS: central ... Page of Chromatographic analysis was performed using a Waters ACQUITY UPLC (Milford, MA, USA) Separation of the analytes from potentially interfering material was achieved at ambient temperature ... Neale JH: Local administration of Nacetylaspartylglutamate (NAAG) peptidase inhibitors is analgesic in peripheral pain in rats Eur J Neurosci 2007, 25:147-158 22 Cangro CB, Namboodiri MA, Sklar...
Ngày tải lên: 20/06/2014, 03:20
Báo cáo toán học: "VEGF T-1498C polymorphism, a predictive marker of differentiation of colorectal adenocarcinomas in Japanese" docx
... C-7-allele probe T-7-allele probe GTGTGGGTGAGTGAGTGTGT GTGACCCCTGGCCTTCTC VIC-CTCCAACaCCCTCAAC FAM-CCAACgCCCTCAAC CCGAGCCGGAGAGGGA GCACCCAAGACAGCAGAAAGT VIC-CATGGTTTCgGAGGCC FAM-ATGGTTTCaGAGGCC ... Komoto C, Nakamura T, Sakaeda T, et al MDR1 haplotype frequencies in Japanese and Caucasian, and in Japanese patients with colorectal cancer and esophageal cancer Drug Metab Pharmacokinet 2006; ... commercially available kit (LABOASSAYTM ALP, Wako Pure Chemical Industries, Ltd., Osaka, Japan) in cell lysates prepared with an ultrasonic cell disrupter: the activity was assessed as the rate of...
Ngày tải lên: 08/08/2014, 17:20
báo cáo khoa học: "A Study to investigate the role of p27 and Cyclin E immunoexpression as a prognostic factor in early breast carcinoma" pptx
... Table p27 and cyclin E statistical associations p27 Cyclin E All invasive carcinomas Infiltrating duct carcinomas only All invasive carcinomas Infiltrating duct carcinomas only Distant metastases ... was a significant association of age, grade, lymph node spread and vascular invasion with distant metastases free survival (MFS) in all invasive carcinomas and the subgroup of IDC in an univariate ... distant metastases in all invasive carcinomas, the subgroup of invasive ductal carcinomas and in the node negative group when cyclin E was stratified as negative and positive (low/high) Many...
Ngày tải lên: 09/08/2014, 01:24
báo cáo khoa học: "CCR9-CCL25 interactions promote cisplatin resistance in breast cancer cell through Akt activation in a PI3K-dependent and FAK-independent fashion" pptx
... Malet A, Saigi E, Rey M: Gastrointestinal stromal tumors Abdom Imaging 2006, 31(4):387-399 Chamadol N, Laopaiboon V, Promsorn J, Bhudhisawasd V, Pagkhem A, Pairojkul C: Gastrointestinal stromal tumor: ... Akriviadis E, Drevelegas A: Gastrointestinal stromal tumors: a pictorial review J Gastrointestin Liver Dis 2009, 18(3):379-383 Darnell A, Dalmau E, Pericay C, Musulen E, Martin J, Puig J, Malet A, ... part was noted Discussion GISTs are uncommon tumors originating from the interstitial cells of Cajal, which are pacemaker cells regulating autonomic motor activity in the gastrointestinal tract...
Ngày tải lên: 09/08/2014, 01:24
Báo cáo khoa học: "Predictive factors for breast cancer in patients diagnosed atypical ductal hyperplasia at core needle biopsy" doc
... invasive cancer All patients in this study underwent clinical and radiological examination, including mammography and ultrasound The radiological appearance of the lesion was characterized according ... finding of mass and microcalcifications was a significant predictive factor for underestimation in the univariate analysis It has been suggested that microcalcification on mammography is an independent ... Proliferative breast "disease" An unresolved diagnostic dilemma Cancer 1993, 71:3798-3807 Shackney SE, Silverman JF: Molecular evolutionary patterns in breast cancer Advances in anatomic pathology...
Ngày tải lên: 09/08/2014, 04:21
Báo cáo khoa học: "A biologically competitive 21 days hypofractionation scheme with weekly concomitant boost in breast cancer radiotherapy feasibility acute sub-acute and short term late effects" pot
... of acute effects and tumor control, with the standard regimen as well as with the UK START TRIAL A schemes (table 7) The vascular damage was calculated on the basis of the a/ b ratio of capillary ... Sydenham MA, Venables K, Yarnold JR: The UK Standardisation of Breast Radiotherapy (START) Trial A of radiotherapy 17 18 19 20 21 22 23 24 hypofractionation for treatment of early breast cancer: a ... 68(4):1018-23 Jalali R, Malde R, Bhutani R, Budrukkar A, Badwe R, Sarin R: Prospective evaluation of concomitant tumour bed boost with whole breast irradiation in patients with locally advanced breast cancer...
Ngày tải lên: 09/08/2014, 09:20
Báo cáo khoa học: "Postmastectomy irradiation in breast in breast cancer patients with T1-2 and 1-3 positive axillary lymph nodes: Is there a role for radiation therapy" ppsx
... DMe Alive DM Death DM Death DM Death DM Death DM Alive Out-come a Lateral, bMedial, cInvasive ductal carcinoma, dInvasive Paget’s disease, eDistance metastasis patients had lung metastasis and ... nodes in the infra or supraclavicular fossa or in the internal mammary chain was considered as a regional recurrence Any recurrence outside these areas was defined as DM Statistical Analysis LRR and ... clear surgical margins (>1 mm) Axillary lymph node staging was performed in all patients Pathological staging was reviewed based on AJCC 2002 The date of evaluation was January 2009 Patient-related...
Ngày tải lên: 09/08/2014, 09:20
Báo cáo y học: "Period-2: a tumor suppressor gene in breast cancer" pdf
... expressing both Per Figure cancer cell of PER Expression lines in human breast epithelial and breast Expression of PER in human breast epithelial and breast cancer cell lines Total cellular protein ... Human breast cancer and breast epithelial cell lines The human breast cancer cell line MDA-MB-231 and the immortalized MCF-1 0A human breast epithelial cell line were purchased from American Tissue ... expressed in normal human mammary epithelium and at a reduced level in breast cancer cells leading to an alteration in the cell cycle, cell growth, and cell survival Materials and methods Human breast...
Ngày tải lên: 10/08/2014, 09:20
Báo cáo y học: " Involvement of the genicular branches in cystic adventitial disease of the popliteal artery as a possible marker of unfavourable early clinical outcome: a case report" pps
... this article as: Ypsilantis and Tisi: Involvement of the genicular branches in cystic adventitial disease of the popliteal artery as a possible marker of unfavourable early clinical outcome: a case ... Stella N, Mastroddi M, Conteduca F, Maggiore C, Faraglia V: Doppler ultrasonography and exercise testing in diagnosing a popliteal artery adventitial cyst Cardiovasc Ultrasound 2009, 7:23 Mino ... Goodreaau JJ, Bergan JJ: Summary of cases of adventitial cystic disease of the popliteal artery Ann Surg 1979, 189:165-175 Cassar K, Engeset J: Cystic adventitial disease: a trap for the unwary...
Ngày tải lên: 11/08/2014, 12:20
Báo cáo y học: "Down-regulation of kallikrein-related peptidase 5 (KLK5) expression in breast cancer patients: a biomarker for the differential diagnosis of breast lesions" doc
... expression in breast cancer patients: a biomarker for the differential diagnosis of breast lesions Margaritis Avgeris1, Georgia Papachristopoulou1,2, Athanasios Polychronis2 and Andreas Scorilas1* ... physical barriers and cells’ interaction, facilitating angiogenesis and cancer cells’ invasiveness and metastasis [2] Moreover, during the early stages of the disease, KLKs influence the availability ... prognostic biomarkers Apart from breast cancer, the prognostic value of KLK5 expression has already been demonstrated for ovarian, bladder, prostate, colorectal and testicular cancer In ovarian cancer, ...
Ngày tải lên: 13/08/2014, 13:20
Estrogen receptor a mediated long rang chromatin interactions at the ret gene locus in breast cancer
... CATGGGAGAAAGATGTAGTCTGGGAGAC B CTCTTTCGGGACACAGCATCATAATC B CTCTTTCGGGACACAGCATCATAATC C GAAAGGACAGAGAAGGTGCCAGTTG B TTCGGGACACAGCATCATAA D ATCAAACTGGAGGGAGCAGA B TCAGACAGTGCCAGTGGAAG E GCCAGTGGAAGTGTAAGTTGG ... B TCGGGACACAGCATCATAA F GACACTGACAGGATTTACCATACTGTTGG B TCGGGACACAGCATCATAA G GGTCAAGTGTTCCCGTGATCCTACTG B TCGGGACACAGCATCATAA H CACAGGGAAATGCAGCACAGCTAG B AACCCCGTGTGTCCTTCAG I ACCGTCACTTTCCCTGTGTT ... GAACCTCGAGGCCCTGAATTGCCTTGATATCCAGCTCCCAGGAAC AP2γ in ERBS TCCGGGACAACGCGAACAGGGGCTCTGGAC AP1 in ERBS GCAGGTGAGACTGGCAAAGTTTGACCTGCTGCCGG AP4 in ERBS CTGAGTCAGACAAGCAACCGGGGCAGACGCAGGACAAGG FoxA1 in...
Ngày tải lên: 05/10/2015, 21:29
In vivo and in vitro study on potential combination therapy of COL 3 and tamoxifen in breast cancer a pilot study
... inhibitor, has already undergone phase I clinical trials in patients with refractory metastatic cancer[ 121] and AIDSrelated Kaposi’s sarcoma[122] A random phase II trial reported that COL-3 administered ... plasma in patients Also, sodium valproate-pretreated rabbits showed an increase in midazolam brain levels, leading to an increase of the 50 midazolam response[152] Recently, in a pharmacokinetic ... thrombophlebitis, and ocular toxicity[48-50] Tamoxifen can be used in the treatment of metastatic breast cancer in postmenopausal women (Table 1.4) as well as in premenopausal women (adjuvant trials) (Table...
Ngày tải lên: 09/10/2015, 11:24
Báo cáo y học: " Self-reported sickness absence as a risk marker of future disability pension. Prospective findings from the DWECS/DREAM study 1990-2004"
... treating days of sickness absence during 1990 as a continuous variable showed a clear trend of increase in disability pension risk with increase in absence days/yr A 10-day increase in absence days ... used to analyse the associations between the risk factors and the outcome variable The analysis was performed in three stages: initially, analysis was performed to establish the association between ... have analysed the determinants measured using the baseline DWECS questionnaire and disability pension data derived from DREAM among the 4177 persons categorized as 18-45 year old employees at...
Ngày tải lên: 26/10/2012, 10:03
Motivation as a Contributing Factor in Second Language Acquisition
... the individual difference variables alters For example, in a formal setting intelligence and aptitude play a dominant role in learning, while exerting a weaker influence in an informal setting ... university graduation, applying for a job, requesting higher pay based on language ability, reading technical material, translation work or achieving higher social status Instrumental motivation is ... of the amount of time spent studying the language and then output, expressed as linguistic performance when investigating language learning In order to examine language learning in the Japanese...
Ngày tải lên: 06/09/2013, 10:10