hepatitis c and hepatocellular carcinoma

Báo cáo khoa học: Halogenated benzimidazoles and benzotriazoles as inhibitors of the NTPase/helicase activities of hepatitis C and related viruses ppt

Báo cáo khoa học: Halogenated benzimidazoles and benzotriazoles as inhibitors of the NTPase/helicase activities of hepatitis C and related viruses ppt

... truncated 159 aa from the amino terminus, was amplified by PCR using the following primers: forward, 5¢-CATGCC ATGGCGCCATTTTTCTTGAGACATGCC-3¢; reverse, 5¢-CTGGGATCCGTCCGAATCAGGTTCCTTC-3¢ (purchased ... NTPase/helicase activities of hepatitis C (Eur J Biochem 270) 1653 30 Gwack, Y., Kim, D.W., Han, J.H & Choe J (1996) Characterization of RNA binding activity and RNA helicase activity of the hepatitis C ... closure), and intradomain and side-chain conformational changes, occur upon binding of ATP and nucleic acid to ensure ATPase activity Analysis of the mode of binding of ATP in the HCV NTPase/helicase...

Ngày tải lên: 08/03/2014, 02:20

9 659 0
Báo cáo y học: "Lymphopenia and autoimmune diseases" pps

Báo cáo y học: "Lymphopenia and autoimmune diseases" pps

... BALB /c mice, NOD MHC-matched B10 mice and congeneic B6.Idd3.NOD mice that contain a 0.35 centimorgan protective interval from B6 mice and not develop diabetes They found that increasing T cell ... diabetes, indicating a correlation between increased T-cell numbers and disease protection In accordance with this hypothesis, the injection of excess CD4 T cells from NOD mice into pre-diabetic NOD ... facilitated by the depletion of the regulatory T-cell subset A recent publication by Sarvetnick and her group now offers a distinct facet to the concept of controlling the emergence of autoreactive...

Ngày tải lên: 09/08/2014, 01:23

3 199 0
Báo cáo y học: "β Transforming growth factor-β-induced regulatory T cells referee inflammatory and autoimmune diseases" potx

Báo cáo y học: "β Transforming growth factor-β-induced regulatory T cells referee inflammatory and autoimmune diseases" potx

... reactions CD4+CD25+ Treg can suppress CD4+CD25– T cell responses to antigens through a contact-dependent, antigen-nonspecific mechanism involving TGF-β Treg suppress CD4+CD25– responder T cell ... for therapeutic considerations, important new evidence documents that Treg can be expanded and/ or induced de novo from CD4+CD25– precursor T cells How, where, and if the size and function of this ... the uncontrolled T and B cell activation and pathogenesis in SLE can be attributed to a deficiency in CD4+CD25+ regulatory T cells In this regard, one study indicated that CD4+CD25+ T cells were...

Ngày tải lên: 09/08/2014, 06:22

7 311 0
Báo cáo y học: "Development and management of systemic lupus erythematosus in an HIV-infected man with hepatitis C and B co-infection following interferon therapy: a case report" doc

Báo cáo y học: "Development and management of systemic lupus erythematosus in an HIV-infected man with hepatitis C and B co-infection following interferon therapy: a case report" doc

... production by plasmacytoid dendritic cells (pDC) [9] HCV is a potential aetiological factor for SLE and alone can mimic SLE both clinically and serologically; the presence of highly specific autoantibodies ... Journal of Medical Case Reports 2009, 3:7289 http://jmedicalcasereports.com/jmedicalcasereports/article/view/7289 Introduction Co-infection with hepatitis C (HCV) and human immunodeficiency virus (HIV) ... for citation purposes) Journal of Medical Case Reports 2009, 3:7289 http://jmedicalcasereports.com/jmedicalcasereports/article/view/7289 IFN-producing cells and can activate immature dendritic cells...

Ngày tải lên: 11/08/2014, 17:21

5 624 0
autoimmunity and autoimmune diseases

autoimmunity and autoimmune diseases

... of TDTH cells against self-antigens POLYCLONAL LYMPHOCYTE ACTIVATION  A number of viruses and bacteria can induce nonspecific polyclonal B-cell activation (G- bacteria, CMV, EBV) ⇓ inducing the ... dendritic cells, macrophages and cytokines Such responses often lead to the production of granulomas as an expression of chronic stimulation of T cells and macrophages, where there is persistance ... manifestations of keratoconjunctivitis sicca (90%) and xerostomia (80%) - sicca syndrome  When these manifestations occur in the absence of another clearly defined connective tissue disease, the...

Ngày tải lên: 13/08/2014, 09:37

44 351 0
Báo cáo y học: "Weight loss, leukopenia and thrombocytopenia associated with sustained virologic response to Hepatitis C treatmen"

Báo cáo y học: "Weight loss, leukopenia and thrombocytopenia associated with sustained virologic response to Hepatitis C treatmen"

... mass index; HCV = hepatitis C virus; HIV = human immunodeficiency virus; RNA = ribonucleic acid; SD = standard deviation Table 2: Comparison of demographics, clinical characteristics and laboratory ... level, and liver histology and did not reach statistical significance Table 1: Baseline demographic, clinical characteristics and laboratory data of the study population Characteristics Total, ... treatment WBC count less than X 10 cells/µl 34 (83) (23) 0.01* End of treatment platelet count less than 1X 105 cells/µl 36 (88) 7(54) 0.06 Clinically significance relevantce characteristic and laboratory...

Ngày tải lên: 26/10/2012, 09:39

7 519 0
Báo cáo y học: "Hepatitis C Virus (HCV) Infection and Hepatic Steatosis"

Báo cáo y học: "Hepatitis C Virus (HCV) Infection and Hepatic Steatosis"

... University of California, Irvine, California, USA His current research interests include the natural history and management of hepatitis B and C and chemoprevention of hepatocellular carcinoma 56 ... Gambardella M, Andreana A, Tripodi MF, Utili R, Ruggiero G Steatosis accelerates the progression of liver damage of chronic hepatitis C patients and correlates with specific HCV genotype and visceral ... analyze viral and metabolic steatosis as distinct groups Research should also continue to focus on therapies for insulin resistance and steatosis-induced fibrosis in chronic hepatitis C In order...

Ngày tải lên: 02/11/2012, 09:51

4 438 0
Báo cáo y học: "Hepatitis B Virus (HBV) and Hepatitis C Virus (HCV) Dual Infection"

Báo cáo y học: "Hepatitis B Virus (HBV) and Hepatitis C Virus (HCV) Dual Infection"

... seroclearance Int J Med Sci 2006, 60 Dual Infection of HBV and HCV and hepatocellular carcinoma (HCC) Conflict of interest HBV and HCV infections are confirmed causes of HCC What’s the combined ... that occult infection may contribute to chronic liver damage and the development of HCC [32, 33, 34, 35] Cacciola [36] studied the prevalence and clinical significance of occult HBV infection ... effect of HBV and HCV coinfection on HCC? Accumulated epidemiological data suggested that coinfection with HBV and HCV could increase the risk for development of HCC A case-control study [51] conducted...

Ngày tải lên: 02/11/2012, 09:51

6 621 1
Báo cáo y học: "Hepatitis C Virus Serologic and Virologic Tests and Clinical Diagnosis of HCVRelated Liver Disease"

Báo cáo y học: "Hepatitis C Virus Serologic and Virologic Tests and Clinical Diagnosis of HCVRelated Liver Disease"

... to distinguish acute hepatitis C from an acute exacerbation of chronic hepatitis C or an acute hepatitis of another cause in a patient with chronic hepatitis C Acute hepatitis C is very unlikely ... result, the exact prevalence of which is unknown Int J Med Sci 2006, Chronic hepatitis C In patients with clinical or biological signs of chronic liver disease, chronic hepatitis C is certain when ... Reference Center on Viral Hepatitis B, C and delta at the Henri Mondor University Hospital in Créteil, France He focuses on teaching, diagnosis and research in virology, primarily hepatitis C and hepatitis...

Ngày tải lên: 02/11/2012, 09:56

6 612 0
Báo cáo y học: "Incidence of Ocular Zoonoses referred to the Inflammatory and Autoimmune Ocular Diseases Service of the University of Parma - Italy"

Báo cáo y học: "Incidence of Ocular Zoonoses referred to the Inflammatory and Autoimmune Ocular Diseases Service of the University of Parma - Italy"

... [1] The only case of Lyme disease affected a 31 year-old farmer and his ocular manifestations are described in the specific section Figure 1: Geographical location of the province of Parma (Italy) ... (Italy) References Mora P, Vecchi M, Barbera L, Toscani M, Orsoni JG Use of systemic cyclosporin A in a case of severe Toxocara uveitis J Infect 2006; 52:159-161 http://www.medsci.org ... Int J Med Sci 2009, 119 this case the patient had a panuveitis, which recovered only after a combination of medical treatment and surgery, with a final visual acuity of 40% in the affected eye...

Ngày tải lên: 03/11/2012, 11:11

2 448 0
Tài liệu Báo cáo khoa học: Template requirements and binding of hepatitis C virus NS5B polymerase during in vitro RNA synthesis from the 3¢-end of virus minus-strand RNA docx

Tài liệu Báo cáo khoa học: Template requirements and binding of hepatitis C virus NS5B polymerase during in vitro RNA synthesis from the 3¢-end of virus minus-strand RNA docx

... CCCCTGATGGGGGCGTATTTCCACCATGAATCACTCCCC GTGATTCATGGTGGAAATACGCCCCCATCAGGGGGCTGG TTTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGCAGCCTCCAGGA CCCCCCCTCCCGGGAGAGCCATAGTGGTCTGCGGAACCGGTTTT AAAAACCGGTTCCGCAGACCACTATGGCTCTCCCGGGAGGGGGGG TCCTGGAGGCTGCGCCCCCATCAGGGGGCTGGCGCGGCCGCAAAA ... GCCAGCCCCCTGATGGGGGCGA TAATACGACTCACTATAGGGTGCACGGTCTACGAGACCT GCCAGACACTCCACCATGAATCACTCCCCTGTGAGGAACTACTGTCTTCACG TAATACGACTCACTATAGGGTGCACGGTCTACGAGACCT TTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGACACTCCACCATGAATTCT ... TTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGACACTCCACCATGAATTCT AGCCATGGTTT AAACCATGGCTAGAATTCATGGTGGAGTGTCGCCCCCATCAGGGGGCTGGC GCGGCCGCAAA GGCTGCACGACACTCCGCCATGGCTAGACGCTTTC CGTCTAGCCATGGCGGAGTGTCGTGCAGCCTCCAGG CCCCTGATGGGGGCGTATTTCCACCATGAATCACTCCCC...

Ngày tải lên: 20/02/2014, 01:20

15 598 0
Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C ppt

Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C ppt

... liver cirrhosis and a type of liver cancer, hepatocellular carcinoma (HCC) The prevention of chronic hepatitis B and chronic hepatitis C prevents the majority of HCC cases because HBV and HCV are ... of chronic hepatitis B and chronic hepatitis C prevents the majority of HCC cases because HBV and HCV are the leading causes of this type of cancer Although the incidence of acute HBV infection ... surveillance of chronic hepatitis B and hepatitis C cases PREPUBLICATION COPY: UNCORRECTED PROOF Copyright © National Academy of Sciences All rights reserved Hepatitis and Liver Cancer: A National...

Ngày tải lên: 06/03/2014, 01:20

191 458 0
Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C doc

Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C doc

... cirrhosis and a type of liver cancer, hepatocellular carcinoma (HCC) The prevention of chronic hepatitis B and chronic hepatitis C prevents the majority of HCC cases because HBV and HCV are the ... of chronic hepatitis B and chronic hepatitis C prevents the majority of HCC cases because HBV and HCV are the leading causes of this type of cancer Although the incidence of acute HBV infection ... B and Hepatitis C Worldwide, 22 Prevalence and Incidence of Hepatitis B and Hepatitis C in the United States, 25 Hepatitis B, 25 Hepatitis C, 28  Liver Cancer and Liver Disease from Chronic Hepatitis...

Ngày tải lên: 06/03/2014, 01:20

253 370 0
Diagnosis, Management, and Treatment of Hepatitis C: An Update docx

Diagnosis, Management, and Treatment of Hepatitis C: An Update docx

... precautions and others should always practice “safer” sex) Table adapted from “Recommendations for prevention and control of hepatitis C virus (HCV) infection and HCV-related chronic disease.” Centers ... predictors of an SVR come from several sources: registration trials which have strict inclusion and exclusion criteria and may not accurately reflect the general population infected with HCV; community-based ... count 75,000 mm and no evidence of hepatic decompensation (hepatic encephalopathy or ascites), and ● Acceptable hematological and biochemical indices (Hemoglobin 13 g/dL for men and 12 g/dL for...

Ngày tải lên: 08/03/2014, 14:20

40 999 0
Autoimmune Diseases – Contributing Factors, Specific Cases of Autoimmune Diseases, and Stem Cell and Other Therapies pdf

Autoimmune Diseases – Contributing Factors, Specific Cases of Autoimmune Diseases, and Stem Cell and Other Therapies pdf

... beta-cell-specific peptide bound to MHC class I molecules in the presence of beta-cell-specific CD4+ T helper cells The cytotoxic CD8+ T cells then affect beta-cell damage by releasing perforin and ... most convincing evidence of a pathogenic role of insulin specific CD4+ T cells came from a study in which the insulin A1–15 specific T cells were expanded from pancreatic lymph nodes of deceased ... inducing the expression of a specific homing receptor The precytotoxic CD8+ T cells that bear beta-cell-specific autoantigen receptors differentiate into cytotoxic effector T cells upon recognition...

Ngày tải lên: 16/03/2014, 21:20

402 378 0
Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C pdf

Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C pdf

... and state governments should expand services to reduce the harm caused by chronic hepatitis B and hepatitis C The services should include testing to detect infection, counseling to reduce alcohol ... the hepatitis B vaccine has been effective in the reduction of new HBV infections CDC’s Advisory Committee on Immunization Practices (ACIP), which provides recommendations on the control of vaccine-preventable ... the committee recommends that the CDC develop specific agreements with all state and territorial health departments to support core surveillance for acute and chronic hepatitis B and hepatitis C, ...

Ngày tải lên: 22/03/2014, 17:20

4 405 1
Báo cáo sinh học: " Reduced expression of Jak-1 and Tyk-2 proteins leads to interferon resistance in Hepatitis C virus " docx

Báo cáo sinh học: " Reduced expression of Jak-1 and Tyk-2 proteins leads to interferon resistance in Hepatitis C virus " docx

... mechanism of IFN-resistance, HCV replication was eliminated from each cell line by treatment with Cyclosporine-A The success of Cyclosporine-A treatment and absence of HCV RNA in these cured cells ... prototype Con1 sub-genomic replicon HCV RNA (Fig 1A) The HCV replicon is a dicistronic chimeric RNA which contains the gene encoding for neomycin phosphotransferase (conferring resistance to G-418) ... of the sub-genomic replicon and reporter plasmid constructs used in the experiments (A) The HCV replicon is a dicistronic chimeric RNA which contains the gene encoding for neomycin phosphotransferase...

Ngày tải lên: 18/06/2014, 18:20

13 305 0
Báo cáo sinh học: " Hepatitis B virus and hepatitis C virus in pregnant Sudanese women" pot

Báo cáo sinh học: " Hepatitis B virus and hepatitis C virus in pregnant Sudanese women" pot

... prevalence of Anti-HCV Authors' contributions RME and AAD carried out the clinical study and participated in the statistical analysis and procedures, MAE participated in the analysis, IA coordinated ... infections, which could influence the evolution of these diseases [11,12] Parallel and overlapping HIV and blood borne hepatitis epidemics in Africa and Influence of maternal (HIV) co-infection ... free of charge to the entire biomedical community peer reviewed and published immediately upon acceptance cited in PubMed and archived on PubMed Central yours — you keep the copyright BioMedcentral...

Ngày tải lên: 18/06/2014, 18:20

3 400 0
w