helminthic infections and asthma still a challenge for developing countries

... This has concentrated financial activity and decision-making in a few economic organizations and also integrated areas of financial activity earlier separated from one another to ensure transparency ... hedge, and for developing countries, international finance was an opportunity A cosy relationship seemed easy to build It appeared that all that was needed was the liberalization of finance and a monetary ... crises, but to the argument that it has a clear bias towards deflationary macroeconomic policies and forces the state to adopt a deflationary stance to appease financial interests (Patnaik, 2003) To...

Ngày tải lên: 23/12/2013, 13:15

... tích cực vay nợ (kết nghịch) => rủi ro tín dụng cao => người cho vay phản ứng nghịch khơng cho vay, kể người có rủi ro thấp thấp Rủi ro đạo đức (Moral Hazard): Xảy sau giao dịch Người vay có động ... quản trò tài : g q ò Vay nợ khẳng đònh mức độ tín nhiệm/ giá trò doanh nghiệp Tuy vậy, doanh nghiệp vay nợ, rủi ro vơ nợ ( h ù san) cang cao C ù chi phí vơ nợ: ỡ (pha û ) ø Cac hi hí ỡ Chi phí trực ... Slide #14-17 Corporate bond Commercial paper C i l Nguồn tài trợ Mỹ 1970-1985 Government loans loans b f i l by foreigners Trade debt Copyright © 2000 Addison Wesley Longman Slide #14-18 Nguồn...

Ngày tải lên: 20/01/2014, 19:20

... the taxation of financial intermediaries and provision of financial services (Bencivenga and Smith, 1992; Huybens and Smith, 1999; Roubini and Sala-i-Martin, 1992 and Roubini and Sala-i-Martin, ... Lundberg and Majnoni, 2006; Aghion, Banerjee and Manova, 2005; Raddatz, 2006), although financial crises occur in developed and developing countries alike (Demirguc-Kunt and Detragiache, 1998 and ... compare states within the U.S and show that bank branch reform boosted bank-lending quality and accelerated real per capita growth rates Similarly, Guiso, Sapienza and Zingales (2002) examine...

Ngày tải lên: 21/04/2016, 13:21

... research and digital libraries of the future is to handle the increasing automatization of the research sources in a way that makes these resources manageable and available to a broader audience ... European Database on AIDS and HIV infection a bibliographic database focused on grey literature and educational material produced by a group of European documentation centres specialized in AIDS and ... will make your local librarian rarer and rarer[Arms 2000] Another fact that also point in that direction is that one of the major costs for classic libraries are staff, facilities and materials,...

Ngày tải lên: 24/01/2014, 00:20

... Table and Figure 1) We further performed stratified analysis according to asthma type (atopic asthma and non-atopic asthma) , age (children and adult) and ethnicity (Asian and Caucasian and African ... polymorphisms, stratified by asthma type, age and ethnicity Stratified variable asthma type atopic non-atopic age children adult ethnicity Asian Caucasian African Studies of available$ No of Cases No of ... and their up regulation into the airways of asthmatic patients causing tissue damage [23-25] Both atopic asthma and nonatopic asthma are associated with increased levels of RANTES in bronchoalveolar...

Ngày tải lên: 26/10/2012, 09:39

... Liljas A, Kristensen O, Laurberg M, Al-Karadaghi S, Gudkov A, Martemyanov K, Hughes D & Nagaev I (2000) The states, conformational dynamics, and fusidic acid-resistant mutants of elongation factor ... Helgstrand M, Mandava CS, Mulder FA, Liljas A, Sanyal S & Akke M (2007) The ribosomal stalk binds to translation factors IF2, EF-Tu, EF-G and RF3 via a conserved region of the L12 C-terminal domain ... interactions Mutation to introduce a side chain would induce a steric clash and conformational change, and affect the nearby ribosome contact Mutation may disturb ribosome interactions Mutation may...

Ngày tải lên: 06/03/2014, 22:21

... used for RT-PCR were: for the I7 OR (5¢-CGTCAAGGAGAAAAAACCCCGGATCT AAAAAATGGAGCGAAGGAACCACAG-3¢) and (5¢-AG CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA TTTTGCTGCC-3¢); for OR17-40 (5¢-CGTCAAGGAG AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC ... AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC TCATCTCTGAAGAGGATCTG-3¢) and (5¢-GCATG CCTGCAGGTCGACTCTAGAGGATCTCAAGCCAGT GACCGCCTCCC-3¢); for Golf (5¢-GGTACCGCTGCAA TGGGGTGTTTGGGCAAC-3¢) and (5¢-GCGGCCGCCT CAGATCACAAGAGTTCGTACTGC-3¢); ... vector was obtained from pJH2-SSTR2 by homologous recombination introducing the c-myc-OR17-40 coding sequence, using primers (5¢-CGTCAAGGAGAAAAAAC CCCGGATCTAAAAAATGGAGCAGAAACTCATCTC TGAAGAGGATCTG-3¢)...

Ngày tải lên: 07/03/2014, 16:20

... marketing, and specializes in strategy and capability development for consumer brand marketers, marketing services firms, and media companies Arun Rajagopalan is a principal with Booz & Company based ... Offices Asia Beijing Delhi Hong Kong Mumbai Seoul Shanghai Taipei Tokyo Australia, New Zealand & Southeast Asia Bangkok Brisbane Canberra Jakarta Kuala Lumpur Melbourne Sydney Europe Amsterdam Berlin ... media, such as television and print, in digital media In undertaking this challenge, many marketers are focused on social media platforms, such as Facebook and Twitter, and a focused set of portals...

Ngày tải lên: 16/03/2014, 11:20

... PAGE (15% acrylamide) and PhosphorImager analysis To calculate reaction stoichiometries, radiolabeled reaction products and radioactive standards were quantitated using IMAGEQUANT software (Amersham ... Schizophrenia and Depression (JAB), the National Institute of Mental Health (ACN and RWG), the Department of Defense (JAB and AAF), the Department of Veterans A airs (RWG), and the Ella McFadden Charitable ... 20 amino acids of mAK-L (MAAADEPKPKKLKVEAPQA) are replaced by four residues (MTST) in mAK-S This results in a length of 361 and 345 amino acids for mAK-L and mAK-S, respectively Mouse and human...

Ngày tải lên: 16/03/2014, 18:20

... Department of Indonesian and Malay, Faculty of Arts, Monash University, Cayton, Victoria Muhadjir (1995) Menjaring Data dari Teks Lembaran Sastra Universitas Indonesia, edisi khusus:Tautan Sastra ... Muhadjir, bu Kiswartini, and all of my students who have collaborated with me in these efforts to understand Bahasa Indonesia better References R R Hardjadibrata (1969) An Indonesian Newspaper ... China, Indonesia, Malaysia, Thailand, and lead by Japan (see http://www.cicc.or.jp/homepage/english/about /a ct/mt/mt.htm, http://www.aia.bppt.go.id/mmts) Unfortunately, there are very few publications...

Ngày tải lên: 17/03/2014, 07:20

... fails to adapt style and materials to communicate straightforward information With guidance, adapts style and materials to communicate straightforward information Independently adapts style and ... standards appear here> Teamwork Below Expectations Meets Expectations Role Model Achieving ... adapts style and materials to communicate information Organizational Know-How Below Expectations Meets Expectations Role Model

Ngày tải lên: 17/03/2014, 15:20

... somewhat mitigated (Ogawa and Retherford 1997; da Vanza and Chan 1994) Economic growth is typically also accompanied by urbanization and the migration of young workers to urban areas In Japan this ... resulting from the added physical and financial burden faced by them from caring for orphans and persons with HIV/AIDS (Ainsworth and Dayton 2001; Barnett and Blaikie 1992; Vanlandingham et al 2000, WHO ... medical care spending: Standard and non-standard effects.” Working Paper #6866 Cambridge, MA: National Bureau of Economic Research Dang, Thai Than, Pablo Antolin, and Howard Oxley 2001 “Fiscal...

Ngày tải lên: 22/03/2014, 13:20

... Iizumi Y, Sagara H, Kabe Y, Azuma M, Kume K, Ogawa M, Nagai T, Gillespie PG, Sasakawa C & Handa H (2007) The enteropathogenic E coli effector EspB facillitates microvillus effacing and antiphagocytosis ... actin filaments that accumulate at pedestals formed underneath the attachment site of bacterial cell 2410 cell (Fig 1) that serves as a conduit between bacterial and host-cell membranes Pore formation ... 2403–2408 Hamaguchi M, Hamada D, Suzuki KN, Sakata I & Yanagihara I (2008) Molecular basis of actin reorganization promoted by binding of enterohaemorrhagic Escherichia coli EspB to a- catenin FEBS...

Ngày tải lên: 29/03/2014, 09:20

Ngày tải lên: 17/04/2014, 15:34

... (PAN) for patient monitoring Fort et al in [9] create a model to understand radio narrow band propagation near the body at the 915 MHz and 2.45 GHz bands A model is developed for path loss, small-scale ... created for each trial A second Java program (Analyze.java) was developed to analyze the saved files containing the received packets Since the transmitted data is known, this program can easily calculate ... for that particular packet All of these packets are picked up by BaseStation.java listening on the USB port and it saves each consecutive packet in a file for future analysis A new file is created...

Ngày tải lên: 21/06/2014, 18:20

... Airedale, stakeholder consultation in the area of child and maternal health care with a range of commissioners and practitioners revealed the importance of maternal mental health as a focus for activity ... [11,20] The data will be analysed using a framework approach [21]: familiarisation with the data, identification of a thematic framework, indexing, charting, and finally, mapping and interpretation ... organisation) to translate research-based findings into practice in the areas of maternal mental health and stroke care, and with Leeds Partnership Foundation Trust (a provider of mental health...

Ngày tải lên: 10/08/2014, 10:22

... Newberry for editorial assistance and Nancee Inouye for research assistance associated with the project Author details RAND Health, Santa Monica, California, USA 2Department of Medicine, David Geffen ... explanatory and participatory (or practical) research trials Combining explanatory and participatory trials may be an effective strategy for including community practice settings in research that ... quantitative and qualitative value of their participation in studies A clinical trial registry would also provide a venue for sharing trial data among participants of ongoing trials, potentially...

Ngày tải lên: 10/08/2014, 10:23

... included footwear was also reported Intra-rater and inter-rater reliability for all categorical data was evaluated using percentage agreement, and kappa (κ) statistics [51,52] Kappa values above 0.80 ... Intra-rater ICCs and 95% LOAs for quantitative measures are shown in Table Similar intra-rater reliability was found for both raters across all measures Most quantitative measures demonstrated ... forefoot height, and longitudinal profile demonstrated at least substantial intra-rater reliability and at least moderate inter-rater reliability for all measures The percentage agreement statistic...

Ngày tải lên: 10/08/2014, 21:23

... extraction postoperative panoramic radiographs after tooth extraction and bone augmentation Figure and bone augmentation postoperative panoramic radiographs after implant setting postoperative panoramic ... iliac alveolar (below) using autogenousmaxilla (above) and the alveolar ridge augmentation of the maxilla (above) and the mandible (below) using autogenous bone grafts from the iliac crest Page ... the lacking bone, a bilateral sinus lifting procedure and a simultaneous alveolar ridge augmentation of the maxilla and the mandible using autogenous corticocancellous block and particulate bone...

Ngày tải lên: 12/08/2014, 00:20