he comes from a community that does not believe in immuniz
Why Copying LIS from a Developed Country Does Not Work for a Developing Country?
Ngày tải lên :
18/10/2013, 14:15
... and social implications The LIS suitable for developing countries must be capable of providing a sound base for economic and environmental planning This is certainly the theory in developed ... countries but there is little evidence that it is so in practice Accordingly developing countries may require a more complex approach to an LIS than the relatively simple use of the LIS in many developed ... ệ ố ấ ể From Pharaohs to Geoinformatics FIG Working Week 2005 and GSDI-8 Cairo, Egypt April 16-21, 2005 ộ TS – Applied SIM and SDI Trung Tran and Don Grant TS9.6 Why Copying LIS from a Developed...
- 2
- 422
- 0
Báo cáo sinh học: " Evidence that spontaneous reactivation of herpes virus does not occur in mice" pdf
Ngày tải lên :
19/06/2014, 08:20
... ganglia transplanted during acute infection and in ganglia transplanted following reactivation was obtained by performing immunohistochemical staining for HSV-1 antigens in tissue sections Staining ... Following viral attachment, the supernatant was removed and a 0.5% methylcellulose overlay was placed in each well The plates were incubated for days and plaques counted The remaining 10 ganglia Page ... viral antigens (a) Immunohistochemical staining of a tissue section through the ear graft site of a BALB/c scid mouse containing a ganglion from an acutely infected donor days after grafting In...
- 12
- 225
- 0
báo cáo hóa học:" Evidence that spontaneous reactivation of herpes virus does not occur in mice" docx
Ngày tải lên :
20/06/2014, 04:20
... ganglia transplanted during acute infection and in ganglia transplanted following reactivation was obtained by performing immunohistochemical staining for HSV-1 antigens in tissue sections Staining ... Following viral attachment, the supernatant was removed and a 0.5% methylcellulose overlay was placed in each well The plates were incubated for days and plaques counted The remaining 10 ganglia Page ... viral antigens (a) Immunohistochemical staining of a tissue section through the ear graft site of a BALB/c scid mouse containing a ganglion from an acutely infected donor days after grafting In...
- 12
- 255
- 0
Báo cáo khoa học: "Prevalence and demographics of anxiety disorders: a snapshot from a community health centre in Pakistan" ppsx
Ngày tải lên :
08/08/2014, 23:20
... load of the family, or whether the underlying grief may make them an added dependant person in the family The local data reports that loss of a parent, sibling or a family member is not associated ... visiting Aga Khan University Hospital (AKUH), a public tertiary care facility, in Karachi, Pakistan The sample was collected via convenience sampling from the outpatient family medicine clinics and ... observation is made only at a particular duration in time; therefore we cannot conclude that the observations are a constant factor in the studied population or a finding at only one point in time...
- 6
- 486
- 0
Báo cáo y học: " Baseline factors predictive of serious suicidality at follow-up: findings focussing on age and gender from a community-based study" pdf
Ngày tải lên :
11/08/2014, 16:22
... National Health and Medical Research Council Grants 179805 and 79839, a grant from the AlcoholRelated Medical Research Grant Scheme of the Australian Brewers' Foundation and a grant from the Australian ... contributions All authors have read and approved the final manuscript AKF-S conceived the study, performed the majority of the statistical analysis and drafted the manuscript KJA was involved in critically ... differences[27], there are many advantages of this approach[28] These include the capacity to compare baseline and follow-up rates of suicidal ideation, and suicide attempt and provide insight into the influence...
- 10
- 268
- 0
Tài liệu Báo cáo khoa học: Analyzing changes of chromatin-bound replication proteins occurring in response to and after release from a hypoxic block of replicon initiation in T24 cells pptx
Ngày tải lên :
21/02/2014, 00:20
... replication, and secondly the elaboration of a protocol for preparing a cell fraction that contains the cellular chromatin and specifically retains the functionally bound (replication) proteins In ... were washed three times for with NaCl/Pi During the last wash total DNA was stained with bisbenzimide (2 lgÆmL)1 in NaCl/Pi) Finally PCNA (Alexa FluorÒ 568 stain), replicating DNA (FITC stain) and ... further normoxic gassing first mitotic cells appear after about 13 h, their number increases within the next h and decreases again at longer incubation A similar increase of DNA synthesis occurs in...
- 11
- 610
- 0
Báo cáo khoa học: Possible involvement of an FKBP family member protein from a psychrotrophic bacterium Shewanella sp. SIB1 in cold-adaptation potx
Ngày tải lên :
16/03/2014, 16:20
... with adaptation at these conditions usually increase More specifically, the cellular content of a protein that is involved in coldadaptation, may increase when the cells are grown at the temperatures ... than the optimum one It is uncertain, however, whether such an increase is a cause or effect of adaptation To examine whether such a coldadaptation mechanism is present in Shewanella sp strain ... 5¢-AGAGAGAATTCATATGTCAGATTTGTTCAG-3¢ for the 5¢-primer and 5¢-GGCCACTGGATCCAACT ACAGCAATTCTCA-3¢ for the 3¢-primer, where underlined bases show the positions of the NdeI and BamHI sites for the 5¢-...
- 10
- 436
- 0
báo cáo hóa học:" CMV retinitis screening and treatment in a resource-poor setting: three-year experience from a primary care HIV/AIDS programme in Myanmar" ppt
Ngày tải lên :
20/06/2014, 08:20
... clinical examination of the retina Screening criteria were broad, reflecting the principle that examination of the retina should be part of the basic physical examination of all AIDS patients at ... secondary to retinal detachment AIDS clinicians working in locations where intraocular injection skills were otherwise not available were carefully trained in intraocular injection of ganciclovir ... screened in Shan State and 292 in Kachin State The five physicians who participated in the first workshop were assessed with a Kappa agreement analysis for their ability to diagnose active and inactive...
- 6
- 349
- 0
Báo cáo hóa học: " Research Article Array Iterators in Lustre: From a Language Extension to Its Exploitation in Validation Lionel Morel" doc
Ngày tải lên :
22/06/2014, 22:20
... into account in the validation process Concerning verification, the approach that has been applied traditionally consists in expanding the arrays into independent variables and use standard validation ... found in [12] 2.3.1 Example We want to build a Lustre program that takes as input an integer flow V and builds an array T that contains the values of V in the last 10 instants (this number of instants ... for every call to that node, this parameter be instantiated by a static constant Finally, the with operator allows for a static recursion mechanism in the language Here, static means that this recursion...
- 16
- 296
- 0
Báo cáo y học: " Intragenic transcriptional cis-activation of the human immunodeficiency virus 1 does not result in allele-specific inhibition of the endogenous gene" pdf
Ngày tải lên :
13/08/2014, 05:21
... CxCAGCGTCCGCxCACTTCCTCCCCAAAACCCCxCCAAAAAAATTGTTxT AxGGTTGGTATAAACACAxAAAGCATGGTGGTxGTCTGGAGCTGGGGTTxA AxTGCAGTGAGCCATGAxCACACCACAGTACxACAGCCTGGGTGATGAAxA AxATTGCTGTCCTAAxCAGACTGCACCTGTGGxGTGGCTCTGACTGGTxA AxGGTATGGTGGCAAAxCGACTCCCCCAGxACAACCACCAGAATATCAGxA ... AxGGTATGGTGGCAAAxCGACTCCCCCAGxACAACCACCAGAATATCAGxA AxACGCCGAAGTCGCxGAAGCAGATCTATCTGCxCTATGGTAAATCTGGxA AxATAACTGTTGCTAGGxGACGGGGACATTCCCGAAxGCTGCGTCTGTxA Modified aminoallyl thymidines in the probes are ... AGTCGCCGCCCCTCGCCTCCTGC GGATTAACTGCGAATCGTTCTAGC CGTCTGTTGTGTGACTCTGGTAACT GTCTCTTTCCTCACTTCTTTCT TCACAGTTTCCAGAACTCCAC GGAATGGAACAGTGAAGAAGCA AATGGTAGATAACGCAGATCATC ACCACTGGAAAGGAACTAAGCA PROBES FOR RNA FISH...
- 15
- 329
- 0
Báo cáo y học: " Open Access SIVSM/HIV-2 Vpx proteins promote retroviral escape from a proteasome-dependent restriction pathway present in human dendritic cells" ppt
Ngày tải lên :
13/08/2014, 09:20
... AC293-CACC GCAGATATCCTGTTTG (nt 7975–7994) for MLV ; mitochondrial DNA, 98-GAATGTCTG CACAGCCACTTTCCAC and 99-GATCGTGG TGATTTAGAGGGTGAAC; actinup-CGAGA AGATGACCCAGATC, actindown-TGCCGCC AGACAGCACTGTG ... CAGGCTCAGATCTGGTCTAAC (nt 465–489) and AC35 for HIV-1, AC377TGTCGAGTAT CTGTGTAATCTTTTTTACC (nt 292–320) and AC378-AAAAGTCCTCAACAAAGAGACTC (nt 217– 239) for FIV, AC292-GCTGTTGCAT CCGACTCGTG (nt 60–79) and AC293-CACC ... pre-incubation HIV-1 FL viral DNA accumulated rapidly within the first hrs and increased only marginally thereafter By 48 hrs post-infection the overall amounts of FL viral DNA attained similar...
- 11
- 280
- 0
Topics from a to z steps to success in listening and speaking (book 1)
Ngày tải lên :
30/08/2016, 13:28
... listen again and answer the questions I Where \, as the blackout? b in Ohio a in Mexico Where was the woman? a al work b at home What was she doing? b fixing her Fax machine a sending a Fax What ... (F) Change the false statements to true ones -c \ The man and woman want to be in the play , The woman will take any part in the play I The man will take any part in the play The woman read about ... the play in The Actor's Newspaper The woman heard about the play from her uncle The woman's dad is an actor in the play Conversation Practice A PAIRS look at the picture Complete the conversation...
- 131
- 794
- 0
Báo cáo khoa học: "A pre-operative elevated neutrophil: lymphocyte ratio does not predict survival from oesophageal cancer resection" pps
Ngày tải lên :
09/08/2014, 03:21
... diagnosis, staging and survival were extracted from the database Pathological staging was determined using the American Joint Committee on Oesophageal Cancer staging, which stages tumours according ... other gastrointestinal cancers, including hepatocellular and colorectal carcinoma [13,15,16,19] The role of NLR in patients undergoing oesophageal cancer resection does not yet appear to have been ... ulceration, epithelial regeneration dysplasia and in some cases malignant change Oesophageal cancer can be preceded by Barrett’s oesophagus, also a chronic inflammatory process involving metaplasia...
- 10
- 224
- 0
How to setup a Linux system that can boot directly from a software RAID
Ngày tải lên :
18/09/2012, 10:11
... the boot loader: Once the configuration installation options are provides, the installation of the system starts: Notice that while the system is installing, the software RAID transparently initializes ... replace the failed one is available it can be installed into the system, partitioned to have the two software RAID partitions to replace the ones of the failed drive The new partitions can be added ... disks already contains data, make a backup if needed (all existing data of partitions involved in the process will be lost), and delete or resize existing partitions to create space for the software...
- 14
- 567
- 1
Women’s Health & Abortion: Evidence shows that legalizing abortion does not reduce maternal mortality docx
Ngày tải lên :
05/03/2014, 15:20
... and 2008 are Maldives, Romania, Iran and Bhutan.6 Three of these countries (excepting Romania) have maintained bans on abortion In the Central American nations of Nicaragua and El Salvador, abortion ... maternal mortality remains prevalent in the developing world In many cases, basic maternal and prenatal health care are lacking Often there is no birth attendant, the medical environment is not ... uterine perforation abortion on demand, is falling behind Chile in its quality of Non-surgical or chemical (RU486) abortion can cause maternal health care severe pain, cramping, nausea, hemorrhage,...
- 4
- 292
- 0
Báo cáo khoa học: Trigger factor interacts with the signal peptide of nascent Tat substrates but does not play a critical role in Tat-mediated export pptx
Ngày tải lên :
07/03/2014, 16:20
... pC4Meth-100TorA/P2 was constructed by PCR, using pTorA/P2 [17] as a template and the primers RRTorA-SacI-fw (5¢-GCGCGGAGCTCAAGAAGGA AGAAAAATAATGAAC-3¢, SacI site underlined) and TorA/Lep2-BamHI-rv (5¢-GCATGGATCCCGCGCGC ... SufIHAXbaI+ClaI-rv (5¢-ACTGATCGATCTAGATTACGCAT AGTCAGGAACATCGTATGGGTAGCCGCCTGGCG GTACCGGATTGACCAAC-3¢, ClaI site underlined, XbaI site in italics, HA-epitope sequence in boldface) The resulting fragments ... on the export of proteins that follow disparate targeting/translocation pathways In conclusion, the data suggest that TF, although interacting with Tat signal peptides, does not play a critical...
- 9
- 393
- 0
Báo cáo khoa học: Synthesis and characterization of Pi4, a scorpion toxin from Pandinus imperator that acts on K+ channels doc
Ngày tải lên :
17/03/2014, 10:20
... sidechains to contact across the molecular interface In the ab initio simulations, the entire molecular surface was searched using absolutely no additional information regarding the binding sites Among ... rat brain synaptosomes by either unlabeled apamin (d) or sPi4 (s) in a competition assay B0 is the binding of [125I]apamin without any other ligand, and B is the binding in the presence of the ... separated by HPLC, then characterized by amino acid analysis, Edman sequencing and mass spectrometry (Fig 4) The results obtained from these techniques unambiguously map the half-cystine pairings...
- 10
- 503
- 0
Báo cáo Y học: A Ca2+/CaM-dependent kinase from pea is stress regulated and in vitro phosphorylates a protein that binds to AtCaM5 promoter ppt
Ngày tải lên :
18/03/2014, 01:20
... promoter fragment The sequences of the oligonucleotides used for these experiments are: Oligo I, 5¢-CAAGGACGTTCGATGCA CTTCCAAAAAACATATAAT-3¢; Oligo II, 5¢-CAAT GTAGTATTAAAAAGTAGTAGTTAAAAGC-3¢; Oligo ... 5¢-GATGTTGATGGTGATGGTCA-3¢; reverse primer: 5¢-AAACCAGCCATGAATGAAAT-3¢) and with actin primers (forward primer: 5¢-GTTGGGAT GAACCAGAAGGA-3¢; reverse primer: 5¢-GAACCA CCGATCCAGACACT-3¢) as a control ... PsCCaMK is present in the nuclear protein fractions as well as in the protein fractions eluted from the heparin–agarose column and possibly interacts with the AtCaM5 promoter In animal systems, a...
- 12
- 365
- 0
Does weight loss improve semen quality and reproductive hormones? results from a cohort of severely obese men doc
Ngày tải lên :
22/03/2014, 12:20
... design, acquisition of data, analysis and interpretation of data All authors read and approved the final manuscript Competing interests The authors declare that they have no competing interests ... design and analysis and interpretation of data CYA contributed to acquisition of data and interpretation of data MB contributed to acquisition of data and interpretation of the data EHE contributed ... obtain an approximate linear distribution of residuals, whereas no transformations were used on data in the longitudinal study In the longitudinal study, differences in semen characteristics and...
- 8
- 736
- 0