harley brilliana c 1600 1643 british royal who sided with the puritans
Influenza vaccination for healthcare workers who work with the elderly (Review) docx
Ngày tải lên :
28/03/2014, 16:20
... non-speci c outcomes pooled data from three C- RCTs showed HCW vaccination reduced ILI; data from one C- RCT that HCW vaccination reduced GP consultations for ILI; and pooled data from three C- RCTs ... Some HCWs remain unvaccinated because they not perceive risk, doubt vaccine efficacy and are concerned about side effects This review did not find information on co-interventions with HCW vaccination: ... effect on the key speci c outcomes of laboratory-proven influenza, pneumonia and deaths from pneumonia, with the 95% confidence interval (CI) in each case including unity For the non-speci c outcomes...
- 60
- 490
- 0
Báo cáo khoa học: The C-terminal region of CHD3/ZFH interacts with the CIDD region of the Ets transcription factor ERM and represses transcription of the human presenilin 1 gene pot
Ngày tải lên :
30/03/2014, 09:20
... GATCGAATTCTGGCGGGGAACAAGCCG, GATCGAATTCTGCACAAGGTTCTGAACCA, GATCGAATTCTGAGCGACATGAAGGCGGAC, GATCGAATTCTAGCGGACGTGACCCGCCTG, GATCGAATTCCCATCGCAGCCCGCCTTCAGATG, GATCGAATTCTCAGCCGGCTGGCCAGCA, GATCGAATTCCTCACCCCACACCGGCCTAC, ... GATCGAATTCCTCACCCCACACCGGCCTAC, GATCGAATTCCCTACGCTACACCTCCG, GATCGAATTCTGGCCGCCGCAGGC, GATCGTCGACTCATGCAGGCATCTGGCTGTAATTG GATCGTCGACTCAGCTGCGCTCGGACATCTGAAGGC GATCGTCGACTCATATTCGGGACAGCGTGGCTG GATCGTCGACTCACGCCTTCATGTCGCTCAGCAAC ... GATCGAATTCTTTGTCTGTGACCCAGATGC GATCGGATCCTTAGAGGGCATCTGGGTCACAG GATCGGATCCACTCCGCCACTCAGAAACTTAG GATCGAATTCTCACCCACCCATCAGAATC GATCGAATTCCCCCTGCAGATGCCAAAGATG GATCGAATTCGAAGTGCCTAACTGC GATCGAATTCGAGAGACTGGAAGGCAAAG...
- 15
- 323
- 0
Tài liệu Cancer Pain Management: A perspective from the British Pain Society, supported by the Association for Palliative Medicine and the Royal College of General Practitioners docx
Ngày tải lên :
14/02/2014, 21:20
... 31 Chapter Modern pharmacological management of cancer pain 41 Chapter Psychological aspects and approaches to pain management in cancer survivors 49 Chapter Physical therapies for cancer ... 55 Chapter Invasive procedures for cancer pain 63 Chapter Complementary therapies for cancer pain 73 Chapter 10 Cancer pain management in the community 77 Chapter 11 Pain related to cancer ... Sodium channels, which in turn activate calcium channels, can be blocked by local anaesthetics and older generation anti-epileptics such as carbamazepine (Dickinson, 2002) Lignocaine patches have...
- 116
- 548
- 0
doctor who, the celestial toymaker based on the bbc television series by brian hayles by arrangement with the british broadcasting corporation
Ngày tải lên :
30/05/2014, 22:55
... whirring clicking mechanisms, the occasional cuckoo from the cuckoo clocks and the loud ticking from the grandfather clocks produced an almost symphonic medley of sound Incongruously, the antique ... inlaid with mother-of-pearl and scenes of Chinese life, after the style of the Willow pattern Further around the room there was a collection of mechanical clocks: some with figurines which came ... two clamps came out of the chair - one across the legs, one across the chest, fastening the doll firmly to the chair which then began to vibrate furiously 'Henry!' cried the Queen appalled The...
- 84
- 419
- 0
rhetorics of martial virtue mapping scottish heroic literature c.1600-1660
Ngày tải lên :
22/12/2014, 16:52
... Gordon couched his instruction in martial conduct within a narrative of epic romance is significant It is in the romance that typical memes of grand heroic acts can be sought, the physical and ... victorie obtaind’ (VII: 5, 5-6), illustrating the extent to which the more conventional erotic accents of the romance genre have been displaced: the war within the hero is not ‘crewell’ because ... the distance between normal speech and art’.19 Penardo’s primary focus, moreover, is the ideological conflict between passion and reason, inasmuch as such conflict can affect the heroic achievements...
- 194
- 195
- 0
Tổng quan về thương mại quốc tế và lý thuyết lợi thế cạnh tranh quốc gia
Ngày tải lên :
23/10/2013, 03:20
... Porter, ngày càng trở nên quan trọng chứ không hề giảm Khi ca c công ty sư c cạnh tranh với ca c đối thủ, vai trò của quô c gia với tư cách là chủ thể chính cung c ́p ca c lợi thế, ... làm nên lợi thế cạnh tranh của một quô c gia gồm: ca c điều kiện nhân tố sản xuất, ca c điều kiện c ̀u, c ́u, chiến lươ c và sự cạnh tranh của ca c công ty,ca c ngành hỗ trợ ... cả tất cả ca c nhân tố Họ có ca c điều kiện ca c yếu tố đầu vào ( trình bày ở phần Mu c II ) Họ có điều kiện c ̀u ( đươ c đề c ̣p ở chương III ) Họ cũng có ca c nhân tố...
- 14
- 691
- 0
đánh giá thực trạng của một số tổ chức tài chính vi mô trên thế giới và bài học nâng cao chất lượng hoạt động của tổ chức tài chính vi mô ở việt nam
Ngày tải lên :
06/02/2014, 20:52
... c p thi t c tài TCVM (TCVM) nghèo, nâng cao TCVM cho : TCTCVM (TCTCVM NHCSXH) dân (QTDND) TCTCVM TCVM TCTCVM TCVM, TCTCVM TCTCVM v TCTCVM T ng quan tình hình nghiên c u: TCVM : TCVM - - C TCVM ... TCTCVM Vi t Nam K t c u c tài TCVM VÀ C C TCTCVM TCVM NAM TCVM TCVM VÀ C C TCTCVM lý thuy t v TCVM 1.1 Khái ni m TCVM Theo ADB TCVM doanh C n theo World Bank TCVM 1.2 - TCVM m c a TCVM TCVM c ... TCVM 2008) TCVM TCVM ng nghiên c u m c tiêu nghiên c u TCVM TCVM Trong , TCTCVM TCTCVM M, CEP B TCVM Thông q hàng Grameen - mô hình TCVM TCVM TCVM u: TCVM c TCTCVM TCVM Ph m vi nghiên c u TCVM...
- 93
- 870
- 0
Tài liệu WHO''''S GOT THE POWER? TRANSFORMING HEALTH SYSTEMS FOR WOMEN AND CHILDREN pptx
Ngày tải lên :
12/02/2014, 23:20
... which it is based The values captured by these principles can be translated into speci c steps, clear priorities, policy directions, and program choices, guided by the scienti c evidence The ... priority focus on ensuring that women who experience life-threatening complications can and access the emergency obstetric care that can save their lives This necessarily means tackling the facility-based ... cases, the causation is direct (clean water directly reduces infection, for example) But in many other cases, the impact of factors outside the health sector is mediated through the health sector...
- 207
- 1K
- 0
Tài liệu Who Needs Emotions? The Brain Meets the Robot JEAN-MARC FELLOUS MICHAEL pdf
Ngày tải lên :
13/02/2014, 09:20
... as a general characterization of the types of component that may occur in a cognitive architecture and preface ix sketch H-CogAff, an instance of the CogAff schema which may replicate human mental ... the experiential aspects of emotion I summarize these aspects in subsequent sections I conclude with the speculation that robots could certainly interact socially with humans within a restricted ... development of computer technology The question “Can machines think?” long predates the computer age but gained new technical perspective with the development of that branch of computer science known...
- 416
- 927
- 0
Tài liệu WHO WILL DO THE SCIENCE OF THE FUTURE? docx
Ngày tải lên :
14/02/2014, 04:20
... asked the National Research Council’s (NRC) Committee on Women in Science and Engineering (CWSE) to host a discussion centered on the challenges facing all scientists in the current scientific climate, ... life the excitement and controversy in scientific research Science controversies can offer 17 students a window on science in the making and showcase the diverse voices contributing to scientific ... representation describing the character of the similarities The teachers helped students to connect chemical similarities to other cases of mistaken identity 22 WHO WILL DO THE SCIENCE OF THE FUTURE? The partnership...
- 104
- 425
- 0
Tài liệu University Oars Being a Critical Enquiry Into the After Health of the Men Who Rowed in the Oxford and Cambridge Boat-Race, from the Year 1829 to 1869, Based on the Personal Experience of the Rowers Themselves pdf
Ngày tải lên :
14/02/2014, 21:20
... learn the names of the crew who so miserably perished, the particular circumstances under which the feat was accomplished, and the year in which it took place In the case of prize-fighters also, whose ... University Matches came off, in which 32 crews competed In the case of each of these crews I have calculated the probable duration of life of the different Oarsmen of whom they were composed: the following ... in the Appendix, is due to the fact that in the one case the expectations of life are calculated solely with a reference to the sixteen men actually engaged in the race, without taking into account...
- 419
- 541
- 0
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf
Ngày tải lên :
18/02/2014, 17:20
... by the complicated relationship between ECs and non-ECs such as mural, hematopoietic and mesenchymal fibroblast cells, even though a conditional genetic modification such as endothelium-speci c ... (MACS) columns and MACS goat anti-rat IgG microbeads (Miltenyi Biotec, Bergisch Galdbach, Germany) were used according to the manufacturer’s protocol Attached cells were trypsinized, collected ... an endothelial-to-mesenchymal transition during early development [33] The presence of these cells may cause a dysfunctional cardiac flow and cause the sudden death of the transgenic mice, although...
- 11
- 873
- 0
Tài liệu Báo cáo khóa học: The C-terminal domain of Escherichia coli Hfq increases the stability of the hexamer ppt
Ngày tải lên :
19/02/2014, 12:20
... Firmicutes, Bacillus/clostridium group – Clope, Clostridium perfringens; Thetn, Thermoanaerobacter tengcongensis Bacillus/staphylococcus group – Bachd, Bacillus halodurans; Stau, Staphylococcus ... measured with a Bruker vector 22 spectrophotometer equipped with a 45 n diamond ATR attachment at 20 C The spectra are the average of 125 scans Spectra were corrected for the linear dependence of the ... and the strand b5 of chain A in the crystal structure [19,20] As the electron microscopy data pointed to a conformational change at the subunits’ interface upon truncation of Hfq, we measured the...
- 8
- 427
- 0
Tài liệu Báo cáo khoa học: A novel nuclear DNA helicase with high specific activity from Pisum sativum catalytically translocates in the 3¢fi5¢ direction docx
Ngày tải lên :
20/02/2014, 11:20
... (C) phosphocellulose, (D) dsDNA-cellulose, and (E) and ssDNA-cellulose columns The detailed description of each chromatographic procedure is given in the text The dotted line indicates the KCl ... activity of PDH120 by actinomycin C1 (B), ethidium bromide (C) , daunorubicin (D) and nogalamycin (E) The DNA helicase reactions were performed in the presence of increasing concentrations of the ... concentration supported 80% of the activity while other divalent cations such as Ca2+, Zn2+, Cd2+, Cu2+, Ni2+, Ag2+ and Co2+ were unable to support the activity (data not shown) The optimum concentration...
- 11
- 573
- 0
WHO''S GOT THE POWER? TRANSFORMING HEALTH SYSTEMS FOR WOMEN AND CHILDREN pptx
Ngày tải lên :
05/03/2014, 10:20
... which it is based The values captured by these principles can be translated into speci c steps, clear priorities, policy directions, and program choices, guided by the scienti c evidence The ... priority focus on ensuring that women who experience life-threatening complications can and access the emergency obstetric care that can save their lives This necessarily means tackling the facility-based ... cases, the causation is direct (clean water directly reduces infection, for example) But in many other cases, the impact of factors outside the health sector is mediated through the health sector...
- 207
- 683
- 0
Professional C# Web Services: Building .NET Web Services with ASP.NET and .NET Remoting potx
Ngày tải lên :
05/03/2014, 22:20
... we can create client-activated objects with the Activator class Well-known objects have to be created with the GetObject() method; client-activated objects require the method CreateInstance() ... we can use the same client application we created earlier to communicate with the new server To complete the picture, we will change the client code as can be seen below: // SimpleClient.cs using ... overhead with different processes, the concept of an application domain was introduced with NET Multiple applications can run in the same process without influencing each other if they are called within...
- 46
- 700
- 0
Báo cáo khoa học: Heterologous synthesis of cytochrome c¢ by Escherichia coli is not dependent on the System I cytochrome c biogenesis machinery ppt
Ngày tải lên :
06/03/2014, 00:20
... cytochromes c, Cys–X–X–Cys–His, was found to be located close to the C- terminus of the PHCP protein, which is conserved in other biochemically characterized cytochromes c (Fig 2) The mature PHCP protein ... sequence deduced from the cloned gene The stretches of the PHCP amino acid sequence used for the design of the PCR primers are underlined with arrows indicating the 5¢ to 3¢ direction The sequences ... thermoluteolus cytochrome c (PHCP) and H thermoluteolus cytochrome c5 52 (PH c5 52) genes are indicated as c and c5 52, respectively The arrow and arrowhead indicate the positions of the PHCP and PH c5 52...
- 8
- 606
- 0
WHO guidelines on the pharmacological treatment of persisting pain in children with medical illnesses docx
Ngày tải lên :
07/03/2014, 04:20
... Disease-related pain in cancer can be acute or chronic (21–23) Causes of acute pain in children with cancer Acute cancer pain can be caused by direct invasion of anatomical structures by the tumour, resulting ... oxygenation can cause chronic pain in limbs and joints Poor circulation can lead to chronic leg ulcers In addition, vertebral collapse can be the source of chronic back pain As chronic pain increases ... unrelated causes or concomitant disease may also occur in children with cancer Metastatic spinal cord compression may be a cause of acute back pain and metastatic brain tumour can cause severe headaches...
- 172
- 4K
- 0