handling gestures in a graphical context such as a game menu

Ngày tải lên: 02/06/2015, 22:58

... rectangle heart triangle star square circle ...

Ngày tải lên: 02/06/2015, 23:04

... extension: tailor-made genes using the polymerase chain reaction Biotechniques 8, 528–535 34 Kanaya S, Katsuda C, Kimura S, Nakai T, Kitakuni E, Nakamura H, Katayanagi K, Morikawa K & Ikehara M (1991) ... RNase HI (Tt-RNase HI) Gly39 and Gly97 are conserved as Gly41 and Gly100 in Tt-RNase HI, respectively Val76 is conserved as Val74 in Ec-RNase HI Asn90 is conserved as Gln96 in RNase HI from a ... 325 a The enzymatic activity was determined at 30 °C using M13 DNA ⁄ RNA hybrid as a substrate, as described in Experimental procedures Each experiment was carried out at least twice and the average...

Ngày tải lên: 18/02/2014, 13:20

... crystals The Tg value after an annealing treatment can be taken as an indicator for the occurred changes in an amorphous/crystal ratio but also in PLA/filler interaction level The increase of an interfacial ... Gries, Eliane Lopes Rosado, Vanessa Chaia Kaippert, Roberta Santiago de Brito, R F B Gonçalves, J A F F Rocco, K Iha, Kazu-masa Yamada, Daniel Plano, Juan Antonio Palop, Carmen Sanmartín, Jindřich ... Ruiz-Sanz, Diana Romanini, Mauricio Javier Braia, Mar a Cecilia Porfiri, Ruel E McKnight, Stefka G Taneva, Sonia Bañuelos, Mar a A Urbaneja, Amal A Elkordy, Robert T Forbes, Brian W Barry, Laura...

Ngày tải lên: 06/03/2014, 22:20

... Post-translational modifications include cleavage of N-terminal or C-terminal fragments, phosphorylation, and glycosylation of amino-acid residues [13] The latter is a remarkable characteristic of many ... Schematic drawing of the isolation of native S-layer proteins from bacterial cells and the reassembly of native and recombinant S-layer proteins into crystalline arrays in suspension, on a solid ... structural organization principles have been identified A cell-wall-targeting domain was found at the N-terminal region of many S-layer proteins, which mediates binding to a specific heteropolysaccharide,...

Ngày tải lên: 16/03/2014, 12:20

... or Asian/Pacific Islander, were black, was Latina, was white, and identified as Israeli Of the four male employees, were black, was Latino, and was white No male employees were plus sized As a ... including carpooling, sharing meals at the corner diner, and attending a movie, a baby shower, and a coworker’s funeral I was open with coworkers about my status as a graduate student, and that I was ... either as top-level managers or as stock associates Top-tier managers included store managers (one Latino man, one black woman), the district manager (an Asian woman), and the regional director (a...

Ngày tải lên: 16/03/2014, 18:20

... result, a range of terms and definitions are used to describe online learning such as web-based training, Internet-based training, e-Learning, advanced distributed learning, and distance education ... students aware that there has been a shift in the emphasis from “learning by the individual” to “learning as part of a community” (Kilpatrick, Jones, & Barrett, 2003) In many cases, like most Asian ... a Foreign Language (EFL) program at Universitas Pelita Harapan (UPH) located in Karawaci–Tangerang, (Indonesia) In order to keep up with the advance of technology in education, the Universitas...

Ngày tải lên: 19/03/2014, 07:20

... spread out between adjacent grains is increased by oxidizing vapours and decreased in the opposite case [6–8], that implies a variation of resistivity in the same way Since 1980, many authors have ... polycrystalline layer made up of grains which have a great disparity of shape and size In this work, the grains are supposed to be quasi-spherical, identical in size, and single-crystal They are jointed, ... was already described The interaction between the gas and the surface was modeled by Langmuir isotherm and the electrical resistivity was evaluated by solving the transport equations This paper...

Ngày tải lên: 20/03/2014, 13:04

... which are characteristic of all forms of social meaning-making, as follows: i ii iii indexical meaning-making practices; intertextual meaning-making practices; meta-discursive meaning-making practices ... Lai Ping, Carlo Prevignano, Duane Savage-Rumbaugh, Susan SavageRumbaugh, Zhang Shaojie, Jared Tagliatela, Godfrey Tanner, Amy Tsui, Theo van Leeuwen, Eija Ventola, and David Wallace To my daughter, ... protolanguage are entrained to the internal organization of language and re-organized as intrinsic linguistic constraints on language form and function The proto-metafunctional character of the infant’s...

Ngày tải lên: 23/03/2014, 15:20

... Anoop Sarkar, Kenji Yamada, Alex Fraser, Shankar Kumar, Libin Shen, David Smith, Katherine Eng, Viren Jain, Zhen Jin, and Dragomir Radev 2003 Syntax for Statistical Machine Translation: Final report ... and Maria Giagkou 2011 Towards using web-crawled data for domain adaptation in statistical machine translation In Proceedings of the 15th Annual Conference of the European Associtation for Machine ... Jian-Yun Nie 2010 Cross-Language Information Retrieval Morgan & Claypool Publishers Vassilina Nikoulina and Marc Dymetman 2008 Experiments in discriminating phrase-based translations on the basis...

Ngày tải lên: 24/03/2014, 03:20

... subordinate clause has no special rhetorical role in a discourse, but acts instead as a temporal adverb Such instances are less problematic for classical approaches than cases like (1,2b), but at ... third stage of processing, as with (2b), both binding and accommodating V to a fail, and so we assume (1",6, 7) The laws that apply are: Narration, States Overlap and the Charm Law The Charm Law is ... defeasible connective as a conditional > The followin~ schemas are some rules for calculating implicatures:" • Narration: (v, a, /3) > Narration (a, /3) • Axiom on Narration: Narration (a, /3) + ea...

Ngày tải lên: 24/03/2014, 05:21

... This way, the students will learn and apply the strategies in the real writing task and the chance that they are going to memorize, generalize, and maintain them is increased A plan for evaluating ... is adapted from the literature on SRSD (e.g Graham and Harris [19]; Mason, Harris and Graham [18]; Harris, Graham and Mason [20]; Chalk, Hagan-Burke and Burke [21]) Information collected at the ... Language Learning: Defining the Field and Effecting Change, Franfurt: Peter Lang, 1999 [5] P Benson, Autonomy in language teaching and learning, Language Teaching 40 (2006) 21 [6] D Little, Language...

Ngày tải lên: 28/03/2014, 11:20

... the information the chart has As a matter of fact, our PGS can be seen as a denotational variant of the chart, and it is managed in a different way by the PG Processor since in the PGS we mainly ... NaturaI Language MIT Press, Cambridge, MA Marino, Massimo (1988) A Process-Activation Based Parsing Algorithm for the Development of Natural Language Grammars Proceedings of 12th International ... D AA B C /x/ D A A C D AAAA (d) (c) Co) B Figure All the possible cases of the example appropriate links are created by means of the actions, and the advantage of this solution is that the search...

Ngày tải lên: 31/03/2014, 18:20

... administration as a discipline which has been recently revived in international debates such as the Commonwealth Association of Public Administration and Management (CAPAM) and the International ... was scarce and wasted through poor management of sanitation and infrastructure; average life expectancy was declining; education outcomes are poor; safety and security was limited; and continued ... Public Management teaching in South Africa to the Indian Institute of Management, Ahmabedabad, India in March 1995 2 Received a National Research Foundation (NRF) research grant to conduct research...

Ngày tải lên: 02/04/2014, 00:13

... extended transition to adulthood, as well as basic definitions of “adult” status that are codified in many other laws and policies As another example, policies that make financial aid and scholarships ... ordering in terms of early adult indicators of economic well-being and health by the age of 31 and 32 We examined college graduation, earnings, savings, and financial difficulties as well as physical ... limitations, and interests; identifying available options and ways to take advantage of them; and, most importantly, being able to set goals that are a good and realistic match to abilities – but also having...

Ngày tải lên: 29/05/2014, 15:46

... keratinocytes Implications for normal and impaired wound healing J Biol Chem 1995, 270:12607-12613 Saaristo A, Tammela T, Farkkila A, Karkkainen M, Suominen E, YlaHerttuala S, Alitalo K: Vascular ... display cellular characteristics of senescence J Vasc Surg 1998, 28:876-883 Hasan A, Murata H, Falabella A, Ochoa S, Zhou L, Badiavas E, Falanga V: Dermal fibroblasts from venous ulcers are unresponsive ... culturing for Mycoplasma in broth [33], and culturing for Mycoplasma on plates [33] Bacterial contaminants were detected using the Gram Stain No determination of the species of bacteria was made...

Ngày tải lên: 18/06/2014, 15:20

... Kappa 10 Kappa 11 C region kappa primer Signal sequence/framework primers Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma 10 Gamma 11 Gamma 12 Gamma 13 Gamma 14 Gamma 15 Gamma 16 C region ... Table 1: Degenerate PCR primers used for amplification of VL (kappa) and VH (gamma) Nomenclature Signal sequence/framework primers Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa ... TCAGCTTCYTGCTAATCAGTG TGGGTATCTGGTRCSTGTG GTTTCMAGGTRCCAGATGT TGTTTTCAAGGTRCCAGATGT CTSTGGTTGTCTGGTGTTGA TGCTKCKCTGGGTTCCAG TGGTGGGAAGATGGA GAGGTGAAGCTGCAGGAGTCAGGACCTAGCCTGGTG AGGTVMAACTGCAGVAGTCWGG...

Ngày tải lên: 18/06/2014, 22:20

... biomonitoring of 2,4TDA, 2,6-TDA, and 4,4’-MDA in hydrolyzed urine and plasma Am Ind Hyg Assoc J 1997, 58(8):587-591 33 Dalene M, Jakobsson K, Rannug A, Skarping G, Hagmar L: MDA in plasma as a biomarker ... the peak areas of individual standards Using this quotient the amine concentrations were estimated with standard curves for each individual isocyanate-amines’ run in parallel Analytical standards ... validation and controls and materials) Data analysis The excretion of the isocyanate diamines was expressed as median values ± SD (standard deviation) of the respective amine, per g creatinine...

Ngày tải lên: 20/06/2014, 00:20

... Kappa 10 Kappa 11 C region kappa primer Signal sequence/framework primers Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma 10 Gamma 11 Gamma 12 Gamma 13 Gamma 14 Gamma 15 Gamma 16 C region ... Table 1: Degenerate PCR primers used for amplification of VL (kappa) and VH (gamma) Nomenclature Signal sequence/framework primers Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa ... TCAGCTTCYTGCTAATCAGTG TGGGTATCTGGTRCSTGTG GTTTCMAGGTRCCAGATGT TGTTTTCAAGGTRCCAGATGT CTSTGGTTGTCTGGTGTTGA TGCTKCKCTGGGTTCCAG TGGTGGGAAGATGGA GAGGTGAAGCTGCAGGAGTCAGGACCTAGCCTGGTG AGGTVMAACTGCAGVAGTCWGG...

Ngày tải lên: 20/06/2014, 04:20

... elderly activity analysis It may also be used in other research areas An interesting example may be traffic analysis; the road can be modeled as an activity zone For such modeling, complete training ... use of context in elderly activity analysis They proposed a method for learning models of spatial context from tracking data A standard overhead camera was used to get tracking information and to ... like walking, sitting, standing up, bending and falling [12] Some application areas that involve visual activity analysis include behavioral biometrics, content-based video analysis, security and...

Ngày tải lên: 20/06/2014, 21:20