gt and gt compounds from this work as with those from other studiesa
Machine learning approach in pharmacokinetics and toxicity prediction
Ngày tải lên :
15/09/2015, 17:10
... RFE method for SVM classification of GT+ and GT- compounds .178 Table 8.4 Overview of the prediction accuracies of GT+ and GT- compounds from this work as with those from other studies ... distinguish between D+ and D- compounds .139 Table 6.9 List of misclassified compounds in this work 144 Table 7.1 Diversity indices of the datasets used in this and other studies 154 ... statistical learning methods and different descriptors sets 157 Table 7.3 Number of compounds with the predicted CLtot within two-fold error of the actual CLtot from this work and other studies .160...
- 358
- 689
- 0
BRANDS ARE BUILT IN THE CONSCIOUSNESS OF THE RECEIVER, NOT BY THE COMPANY potx
Ngày tải lên :
09/03/2014, 00:20
... ago but grew up as a “Kiwi” in New Zealand, a move that was anything but easy for a 5-year-old boy Together with his parents, brother and sister, they sailed from Glasgow to Wellington onboard the ... As in many other industries, design has become increasingly crucial “Appearance and design are things we work a lot with, ” Annergren says technologies – wet and dry crepe as well as TAD (throughair-dried) ... distinct brands “We work in markets with increasingly tougher competition, both from global and strong local competitors with their own brands Moreover, a lot of retailers have their own brands It’s...
- 36
- 485
- 0
Báo cáo hóa học: " The synergistic effect of IFN-α and IFN-γ against HSV-2 replication in Vero cells is not interfered by the plant antiviral 1-cinnamoyl-3, 11-dihydroxymeliacarpin" pptx
Ngày tải lên :
20/06/2014, 01:20
... reduction assay (Figure 1) In cultures treated with 100 IU/ml of IFN-α or IFN-γ, MS and G replication was 8-fold and 100-fold reduced respectively (p < 0.001) at 24 h p.i (Figure 1a and 1b) At 48 and ... combination of IFN-α and IFN- γ was also demonstrated for other members of Herpesviridae [20,23,33] and a variety of RNA viruses like SARS [34], Lassa virus [35] and HCV [25] Considering this background ... treated with CDM 2h prior to interferon induction and then removed; (b) CDM was added simultaneously with IFN and remained only for 16 h before infection; (c) CDM was added after virus infection and...
- 10
- 544
- 0
Báo cáo hóa học: " Effects of rehydration nutrients on H2S metabolism and formation of volatile sulfur compounds by the wine yeast VL3" docx
Ngày tải lên :
20/06/2014, 23:20
... GCTGCCGCTGAAGGTAAG CGAAGATGGAAGAGTGAGAGTC OPT1 TGTCCCGATTGGTGGTATTTAC MET10 CACTCACGTTCCATCCACTACC GTGTTGGTTAGTCATTGCTTCC CACTCACGTTCCATCCACTACC IRC7 CCTGGATTTGGCTGCTTGG AGAACCTTTGTAGTCACGAACC ... Australia) Materials and methods Post fermentation handling Chemicals Analytical reagents were purchased from Sigma-Aldrich unless otherwise specified Rehydration nutrient mix was Dynastart (Laffort ... polyfunctional thiols 3MH and 3MHA increased with the addition of rehydration nutrient while the concentration of hydrogen sulfide was significantly decreased Other sulfur compounds including 4MMP...
- 11
- 505
- 0
báo cáo khoa học: " Awareness of the need for safe storage of Methadone at home is not improved by the use of protocols on recording information giving" doc
Ngày tải lên :
11/08/2014, 18:20
... provision of measuring devices is intended to reduce the use of non-standard containers to measure out methadone When pharmacists were questioned as to whether a measuring device was provided with each ... devised the methodology and was the academic supervisor for AM and wrote the final manuscript All authors read and approved the manuscript Acknowledgements This study was performed as a Medical Student ... dispensed with child resistant caps on This was the only criterion that reached a 100% standard The provision of measuring devices When the methadone is stored in an inappropriate device such as a...
- 6
- 383
- 0
DIRECT TREATMENT OF POLLUTED RIVER WATER BY THE MULTI-SOIL-LAYERING METHOD
Ngày tải lên :
05/09/2013, 08:40
... efficiency of BOD was higher in MSL systems with lower hydrologic loading rate, compared the each set of MSL systems, i.e MSL and 2, and 4, and 6, and was higher in those with smaller size of ... constructed and operated with six different conditions (Table 1) Two types of soils: Andisol, humus rich volcanic ash soil, and Entisol, humus poor granitic sandy soil (MASA soil), and two sizes ... efficiencies of T-N and T-P was declined for MSL1, and 4, general performance of those systems was better than that of MSL6 It was because contact of inlet water and materials inside the system and filtering...
- 8
- 689
- 2
Cadmium Removal by the Hydroponic Culture of Giant Reed (Arundo donax) and Its Concentration in the Plant
Ngày tải lên :
05/09/2013, 10:17
... The results as well as the change in cadmium concentration in culture medium are shown in Fig.5 The large decrease was observed between and day and the temporal increase of GSH in Run was clarified ... also calculated from the linear approximation with the assumption of zero-order kinetics As a result, the rates were estimated as 0.05 to 0.16 mg-P/day/plant with cadmium addition, and 0.09 to 0.14 ... the decrease of the cadmium concentration was large, the GSH concentration was high After day 1, the concentration of cadmium seemed to increase However, it was considered that it was within the...
- 7
- 701
- 0
ENGLISH ADVERBS OF MANNER AND TYPICAL ERRORS MADE BY THE STUDENTS AT LE HONG PHONG SPECIALISED SECONDARY SCHOOL, NAM DINH CITY
Ngày tải lên :
07/09/2013, 13:19
... in detail in this theoretical background The study has been conducted with forty subjects from class 10C and a written test with six tasks as the instrument Data was then collected and analyzed ... the test was 40 Any paper with 20 marks or more is considered “Pass” one In contrast, those papers with fewer 20 marks are seen as “Fail” ones As a result, there are 32 “Pass” papers and “Fail” ... perfectly and got mark the full mark Task one and task two are equal in terms of difficulty with 28 (70%) and 27 (67,5%) students respectively passing In both tasks, no students got mark zero In task...
- 55
- 1.1K
- 8
Tài liệu The Insider’s Guide to PR: Chapter 6 PR IN PRACTICE The following case studies are examples of PR pptx
Ngày tải lên :
13/12/2013, 04:15
... England and Wales with the right information and resources to teach good food hygiene practice • To encourage the teaching of food safety in the classroom • To raise awareness of and encourage basic ... its unique brand and reputation both across Europe and internationally A communications programme was developed to underpin all its marketing efforts and help increase its circulation and readership ... practice These children (twice as many as before the campaign) now understand the risks involved • Extensive media coverage reached two out of five mothers at least twice and just over half of all...
- 4
- 616
- 0
Tài liệu Art of Surface Interpolation-Chapter 5:Solving special tasks In the next sections there are examples of interpolation problems, ppt
Ngày tải lên :
21/01/2014, 07:20
... In this case the constant a was computed as the negative number -1.160139 and together with b (-217.38) changed the grid so that the sum of squared differences between the new 68 surface and ... constructed as surfaces passing through structural depths (z-coordinates) measured in wells As explained in section 5.3 Seismic measurement, layer construction may be combined with seismic measurement, ... W-10 W-11 W-12 W-13 W-14 As follows from the list, the range of depths is -2338 to -2238 meters As a rule, the depth of a geological structure has a negative value measured from some datum plane...
- 17
- 506
- 0
A CASE STUDY ON COMMON PROBLEMS IN LEARNING BUSINESS ENGLISH VOCABUALRY IN THE BOOK “BUSINESS BASICS” FACED BY THE 1ST YEAR STUDENTS AT VIETNAM UNIVERSITY OF COMMERCE, AND SOME SUGGESTED SOLUTIONS
Ngày tải lên :
29/01/2014, 00:23
... researcher They are both male and female, aging from 25 to 50 and have worked with the book “Business Basics” for at least years 4.2 The instruments In order to ensure the validity and reliability of the ... method can work with a number of students but don’t work with the others” All of the teachers have the complaint about the over-size class at the university as they always consisted of from 45 to ... English vocabulary teaching and learning in VUC And the last one presents analysis from data collected from the subjects and instruments employed in the research added with some discussion Finally,...
- 42
- 1.3K
- 3
Tài liệu Báo cáo " Survey of WO3 thin film structure built on ito/glass substrates by the Raman and xrd spectroscopies" doc
Ngày tải lên :
13/02/2014, 03:20
... understand what occurred inside and whether nano particle phases exist, we used their Raman spectroscopy And 600 cm-1 – 1000 cm-1 range was analyzed into different basic vibration With samples with ... 797cm-1; 703cm-1 and 678cm-1 proves that in our thin films, there are two types of crystalline structures: m-WO3 phase with 803 cm-1 and 703cm-1 and t-WO3 phase or o-WO3 phase with the two characteristic ... peak will be focused on in this paper Experimental In this research, ITO and WO3 layers were prepared by magnetron sputtering in (O2 + Ar) plasma Oxygen and argon gases with high purity (99.999%)...
- 9
- 635
- 0
Tài liệu Produced jointly by the British HIV Association (BHIVA), the British Association for Sexual Health & HIV (BASHH) and the Faculty of Family Planning & Reproductive Health Care doc
Ngày tải lên :
13/02/2014, 10:20
... sperm washing and aims to minimise the high costs and risks of multiple pregnancy and ovarian hyperstimulation associated with IVF and ICSI treatment Effect of HIV on semen parameters and the ... prognosis and life expectancy in each should be carefully discussed with the HIV physician56 Safety of healthcare workers and non-infected patients Handling and freezing gametes and embryos from patients ... treated with combined modality chemoradiotherapy.117,118 The 5-year overall survival was 47%, and the 5-year disease free survival was 66% There was no difference in overall survival between pre- and...
- 62
- 553
- 0
Tài liệu Cancer Pain Management: A perspective from the British Pain Society, supported by the Association for Palliative Medicine and the Royal College of General Practitioners docx
Ngày tải lên :
14/02/2014, 21:20
... primary tumours associated with osteoblastic metastases, for example prostate and breast cancers 32 4.1.3 Chemotherapy • Chemotherapy may also provide valuable pain relief for a patient with widespread ... documented bone metastases are asymptomatic), whereas others may have scattered multi-focal pain often flitting from one area to another, which is the clinical scenario Combining radiotherapy with pharmacological ... successfully with brain irradiation (Hoskin, 2000) A solitary metastasis may be best treated with surgical decompression and post-operative radiotherapy; multiple metastases should be treated with whole...
- 116
- 548
- 0
Tài liệu The Role of BCG Vaccine in the Prevention and Control of Tuberculosis in the United States: A Joint Statement by the Advisory Council for the Elimination of Tuberculosis and the Advisory Committee on Immunization Practices docx
Ngày tải lên :
15/02/2014, 13:20
... 1996 number of cases decreased 3.7% from 1993, but this number still represented a 9.7% increase over the rate for 1985 (14 ) In general, active TB disease is fatal for as many as 50% of persons ... lymphadenitis and other complications from BCG vaccine than are persons who are not infected with HIV (53 ) The administration of a larger-than-recommended dose of BCG vaccine was associated with increased ... TB cases were reported by five states (i.e., California, Florida, Illinois, New York, and Texas), and overall incidence rates were twice as high for men as for women (16 ) For children, disease...
- 27
- 1.3K
- 3
Tài liệu TRANSFER CREDIT SERVICES GUIDE: Produced by the Office of the Registrar ppt
Ngày tải lên :
15/02/2014, 14:20
... credit values, and grades Residency Requirement All students, including those transferring from other schools, are required to complete a minimum of 60 credits for the degree and 48 credits for ... all completed work with their Application to the College as soon as that completed work is reported on the transcripts Each Entering class has a deadline to submit transcripts Students can check ... applicable Please Note: Syllabi and/ or cutting and pasting the description into an email are not acceptable Upon review of the official course description, you will be notified as to whether...
- 12
- 384
- 0
Tài liệu cwnaTMCertified Wireless Network AdministratorOfficial Study GuideEndorsed by the Wireless LAN AssociationIndustry Approved!TMExam PW0-100Objective-by-Objective coverage of the CWNA certification examVendor-neutral wireless network trainin pptx
Ngày tải lên :
17/02/2014, 15:20
... Authentication & Association Authentication Association States of Authentication & Association Unauthenticated and Unassociated Authenticated and Unassociated Authenticated and Associated Authentication ... presently, and those will be covered at length in this book Again, as the industry and market place change, so will this book in order to stay current How Is This Book Organized? This Official ... frequencies such as the ones discussed at length in this book Network Extension Wireless networks can serve as an extension to a wired network There may be cases where extending the network would require...
- 390
- 2K
- 2
Tài liệu Audit of Contract Management by the Sectors doc
Ngày tải lên :
17/02/2014, 21:20
... four cases of non-compliance with the basis of payment TABLE – PRICE PAID NOT IN COMPLIANCE WITH THE BASIS OF PAYMENT CONTRACTOR Case Space Operations Case Space Technologies Case Security and ... CERTIFICATION OF PERFORMANCE AND COMPLIANCE OF WORK i) Managers, as well as staff from the sector financial services and accounting services should assume the roles and responsibilities assigned to them ... paid was consistent with the basis of payment specified in the contract In four cases, or nearly 15% of our audit sample, the basis of payment was breached In one case, the breach of the basis...
- 27
- 424
- 0