granulocyte colony stimulating factor g csf

... Drug Administration FPLC Flow Protein Liquid Chromatography G- CSF Granulocyte colony stimulating factor g- csf Gen mã hóa cho protein G- CSF G- CSFR Thụ thể protein G- CSF (G- CSF receptor) G- MCSF Granulocyte ... tạo dòng bạch cầu hạt G- CSF Chương II Nghiên cứu ứng dụng công nghệ gen để tạo dòng vi sinh vật tái tổ hợp tổng hợp hiệu G- CSF 16 Nghiên cứu phân lập dòng gen mã hóa G- CSF người ... (+IPTG) ) dịch 7 6xHis -G- CSF 6xHis -G- CSF B A Hình 11 Kiểm chứng 6xHis-TEV-GCSF Western blot A, kháng thể kháng His; B, kháng thể kháng G- CSF 26 Nghiên cứu tạo dòng E coli tổng hợp G- CSF dạng tan...

Ngày tải lên: 16/04/2014, 11:16

... AAG CTT TCA GGG CTG CGC AAG GTG GCG TA3’ The amplified products were fractionated on agarose gels The G- CSF cDNA eluted from the agarose gel was digested by Bam HI and Hind III, and ligated to plasmid ... OD260 Vehicle 0.65 + 0.12 Wt G- CSF (50 g/ kg) 1.01 + 0.34* G- CSFa (25 g/ kg) 0.95 + 0.13* nm G- CSFa (50 g/ kg) 1.01 + 0.14* G- CSFa (100 g/ kg) 1.02 + 0.20* Irradiated (4 Gy) mice were administered ... 3) G- CSFa was more potent in Figure A comparison of in vitro activity between G- CSFa and wild-type G- CSF Recombinant G- CSFa and G- CSF at indicated concentrations (10 pg, 20 pg, 100 pg, 200 pg,...

Ngày tải lên: 10/08/2014, 21:23

... colony- stimulating factor , granulocyte colony stimulating factor, recombinant”, “GCSF”, “filgrastim”, “lenograstim”, “sargramostim”, “pegfilgrastim”, granulocyte- macrophage colony- stimulating factor , granulocyte- macrophage ... intervals; G- CSF: granulocyte- colony stimulating factor; GMCSF: granulocyte- macrophage colony stimulating factor; LPS: lipopolysaccharide; mHLA-DR: monocytic HLA-DR; PHA: phytohemagglutinin; RCTs: ... doi:10.1186/cc10031 Cite this article as: Bo et al.: Granulocyte- colony stimulating factor (GCSF) and granulocyte- macrophage colony stimulating factor (GM -CSF) for sepsis: a meta-analysis Critical Care 2011...

Ngày tải lên: 14/08/2014, 07:21

... G- CSF Granulocyte colony stimulating factor g- csf Gen mã hoá cho protein hG -CSF G- CSFR Thụ thể protein hG -CSF (hG -CSF receptor) G- MCSF Granulocyte macrophage colony stimulating factor IBs Inclusion ... (G- CSF receptor hay G- CSFR) (Hình 1.4) diện tế bào tiền thân tủy xương kích thích G- CSF G- CSFR g m vùng có chức khác nhau: vùng tế bào để tương tác với G- CSF; vùng xuyên màng giúp định vị G- CSFR ... xuất bạch cầu trung tính thúc đẩy gia tăng cách tiêm G- CSF với liều lượng khoảng 1-10 g/ kg/ngày Những nghiên cứu khác chứng tỏ, G- CSF giúp gia tăng huy động tế bào sơ khai máu ngoại vi, tái sản...

Ngày tải lên: 04/02/2015, 12:46

... complementary primers (forward, 6748 5¢-GCCGGCATGGCACCGTTGGTGGGCTGCAGGG-3¢; and reverse, 5¢-CCCTGCAGCCCACCAACGGTGCCA TGCCGGC-3¢) The PCR product was then digested with 10 U of DpnI, and this was ... docking program, and 100 000 decoys were produced for each of them The analyzed systems were Gln134-restrained docking of both closed-MTGase G- CSF and open-MTGase– G- CSF; Gln134-restrained docking ... sequence LGMAPALQPTQGAMPA and lacked the signal corresponding to Gln134, which is diagnostic of its derivatization This result confirmed that Gln134 is the single PEGylation site of G- CSF, in agreement...

Ngày tải lên: 16/03/2014, 00:20

... The Flag-tagged expression vector was constructed as follows PCR was carried out using BOS-5 (GGGTTTG CCGCCAGAACACA) and BOS-Flag-rev (CCGAATT CCTTGTCATCGTCATCCTTGTAGTCCATGGTGGC CTCACGACACCTGA) ... ATP-binding site of the kinase domain The primers were M13-reverse (CAG GAAACAGCTATGACCAT) and lyn-KNrev (CTTGAG GGTCCTCACAGCCAC) for one reaction, and lyn-KNfor (GTGGCTGTGAGGACCCTCAAG) and Lyn-Crev (GC ... 339, 27±30 Demetri, G. D & Grin, J.D (1991) Granulocyte colonystimulating factor and its receptor Blood 78, 2791±2808 Murakami, H & Nagata, S (1998) Granulocyte colonystimulating factor In The Cytokine...

Ngày tải lên: 17/03/2014, 17:20

... Reverse AATGGACCCGACATTAACCA AAATGGTCGTTTGGCTGAAG AGGAACATCTGGCCAGGCTG ACTTGGGATGCTCCATGGTC CTCAACTTTCTGCCCAGAGG CTGGAAGGCAGAAGTGAAGG CACTCTGGACAGTGCAGGAAG CGACACCTCCAGGAAGCTCTG AAAGGATCCACTGGCGTCTTCACCACC ... AAAGGATCCACTGGCGTCTTCACCACC GAATTCGTCATGGATGACCTTGGCCAG Forward Reverse Forward Reverse TGGCTGGAAGAGAGGAAGAG CTGGGGCAACTCAGGCTTA AACTGGGGACTCTCCCTTTG CTACTCCGTGAAGTGAACAA Primers that can be used ... G- CSF Human G- CSF GAPDH a Oligonucleotides used for the ChIP assay G- CSF promoter iNOS promoter a Forward ACGCGTAGATCCAACACCCTGCAGCGAT Reverse AGATCTGATTCTGGGTGATCTGGGCTGCA Forward Reverse Forward...

Ngày tải lên: 22/03/2014, 17:20

... for G- CSF may become part of the treatment paradigm Abbreviations CRC: colorectal cancer; G- CSF: granulocyte- colony- stimulating factor; GM -CSF: granulocyte- macrophage colony stimulating factor; ... with granulocyte colony- stimulating factor: report of a case Surg Today 2006, 36:63-67 Hirasawa K, Kitamura T, Oka T, Matsushita H: Bladder tumor producing Granulocyte colony- stimulating factor ... Competing interests The authors declare that they have no competing interests Hasegawa S, Suda T, Negi K, Hattori Y: Lung large cell carcinoma producing granulocyte- colony- stimulating factor Ann...

Ngày tải lên: 09/08/2014, 07:21

... during G- CSF doi:10.1186/1752-1947-5-88 Cite this article as: El Husseiny and Mattar: Aggressive cutaneous vasculitis in a patient with chronic lymphatic leukemia following granulocyte colony stimulating ... this context with granulocytic colony- stimulating factor (G- CSF) treatment Cutaneous vasculitis was reported in less than one in 7000 of those treated with G- CSF, and was moderate to severe in intensity ... http://www.jmedicalcasereports.com/content/5/1/88 Page of Figure Vasculitic lesions over the ear lobule Figure Vasculitic lesions on the leg during the first day after lenograstin injection (Figure 6) CBCs (complete blood...

Ngày tải lên: 11/08/2014, 00:22

... [1] reported a case of G- CSF- producing lung cancer Since then, G- CSF- producing tumors have been reported, however, most cases were of lung cancer origin and G- CSF- producing pancreatic cancer is ... Carbohydrate Antigen 19-9; CEA: Carcinoembryonic Antigen; CT: computed tomography; G- CSF: granulocyte- colony stimulating factor; NSE: Neuron-specific enolase; PET: Positron Emission Tomography; sIL-2R: ... granulocyte- colony stimulating factor Hepatogastroenterology 2006, 53(72):957-959 Fukushima N, Sasatomi E, Tokunaga O, Miyahara M: A case of pancreatic cancer with production of granulocyte colony- stimulating...

Ngày tải lên: 11/08/2014, 19:21

... Surgery + epirubicin + taxotere No 22 Bladder cancer Bacterial pneumonia Complete resection No Surgery No ARDS = acute respiratory distress syndrome; G- CSF = granulocyte colony- stimulating factor ... numbers or percentages ARDS = acute respiratory distress syndrome; G- CSF = granulocyte colony- stimulating factor *P < 0.05 for neutropenic patients versus non-neutropenic patients using Fisher's exact ... Ann Intern Med 1996, 125:191-196 Hartung T, Docke WD, Gantner F, Krieger G, Sauer A, Stevens P, Volk HD, Wendel A: Effect of granulocyte colony- stimulating factor treatment on ex vivo blood cytokine...

Ngày tải lên: 13/08/2014, 10:20

... treatment of granulocyte- macrophage colony- stimulating factor (GM -CSF) Peptide peak intensities increased or decreased by the treatment of granulocyte- macrophage colony- stimulating factor (GM -CSF) m/z ... 5'-ggaacaaaagtcctgatccagtagtc-3'; glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (forward) 5'-aatggaaatcccatcaccatctt-3'; GAPDH (reverse) 5'-catcgccccacttgattttg-3' PCR was performed using a ... Detection of trypsin digested peptides from granulocyte- macrophage colony- stimulating factor (GM -CSF) stimulated neutrophils by matrix-assisted Detection of trypsin digested of flight mass spectrometry...

Ngày tải lên: 09/08/2014, 01:22

... colonystimulating factor (GM -CSF) and granulocyte colony- stimulating factor (G- CSF) : receptor biology, signal transduction, and neutrophil activation Blood Rev 1992, 6:43-57 14 Eroglu A, Demirci ... of growth factors erythropoietin and granulocyte macrophage colony stimulating factor on mechanical strength and healing of colonic anastomoses in rats Eur J Surg 1999, 165:986-992 17 Higgins G, ... EPO group (n = 21), that received EPO 500 IU/ kg, a GM -CSF group (n = 21) that received 20 mcg/kg of GM -CSF and an EPO+GMCSF group (n = 21) which received a combination of the above EPO, GM-CSF...

Ngày tải lên: 09/08/2014, 03:21

... Schwarzenberger P, Huang W, Ye P, Oliver P, Manuel M, Zhang Z, Bagby G, Nelson S, Kolls JK: Requirement of endogenous stem cell factor and granulocyte- colony- stimulating factor for IL-17-mediated granulopoiesis ... CXCL8 ***** ****** IL-10 IL-15 Granulocyte macrophage colony- stimulating factor * ** Granulocyte colony- stimulating factor * ** * ***** CCL2 ***** CCL3 * *** * * ... elevated levels of GM -CSF, granulocyte colony- stimulating factor, CCL2 Page of 12 (page number not for citation purposes) Using an inhibitor of the phosphatidylinositol-3-kinase signalling pathway (Ly294002)...

Ngày tải lên: 09/08/2014, 10:23

... Các CSF chia thành ba loại: - G- CSF (Granulocyte- colony stimulating factor) - GM -CSF (Granulocyte macrophage -colony stimulating factor) - M -CSF (Macrophage -colony stimulating factor) Trong đó, G- CSF ... Đường cong tương quan tiêu chuẩn g i phương trình logarit tham số bao g m: giới hạn dưới, giới hạn đường cong, giá trị ED50, giá trị độ nghiêng (Hill slope) Giới hạn giới hạn biểu thị đáp ứng mạnh ... thể động vật thí nghiệm, dự đoán tăng số lượng bạch cầu thể người Ngoài tác động lên số lượng, G- CSF giúp tăng cường chức tế bào bạch cầu trung tính Chúng đóng vai trò quan trọng sức đề kháng thể...

Ngày tải lên: 13/10/2014, 20:47

... normalisation against β-actin expression The sequences of oligonucleotide primers were as follows: for TNFR1, 5' primer GGT GAC TGT CCC AAC TTT GC and 3' primer GGG TCA TCA GTG TCT AGG CT 3'; for ... incubating sections with 10 g/ ml of mouse IgG1 anti-IL10R1 mAb, rabbit IgG anti-TNFR1 Ab, rabbit IgG anti-TNFR2 Ab (Santa Cruz Biotechnology, Inc.), rabbit IgG anti-M-CSFR Ab, mouse IgG1 anti-CD68 ... macrophages characteristic of RA It has been shown that IL-10 augments the macrophage colony- stimulating factor (M -CSF) -induced growth and differentiation of human monocytes, and macrophages generated...

Ngày tải lên: 09/08/2014, 08:22

... osteoclastogenesis on serum levels of (a) osteoprotegerin (OPG), (b) soluble receptor activator of NF-κB ligand (sRANKL), (c) sRANKL/OPG ratio and (d) macrophage colony- stimulating factor Serum ... NFATc1, a key transcriptional factor of osteoclastogenesis induced by macrophage colony- stimulating factor (M -CSF) and receptor activator of NF-κB ligand (RANKL) in a culture of murine precursor cells ... coordinated to regulate bone resorption positively and negatively by controlling the activation state of RANK on osteoclasts The crucial role of the RANKL/RANK/OPG signaling pathways in regulating bone...

Ngày tải lên: 09/08/2014, 10:21

... fungal disease who received adjunctive therapy with recombinant human macrophage colony- stimulating factor Blood 1993, 82:1422-7 Jin Y, Dons L, Kristensson K, Rottenberg ME: Colony- stimulating factor ... transcription factor (in monocytes) results in inflammatory bowel disease in rodents [22,23] These data suggest that a signaling pathway involving G alpha i2, Stat3 and CSF1 R is critical for protection against ... Longelier D, Lapointe G, Gaudet D, Faith J, Branco N, Bull SB, McLeod RS, Griffiths AM, Bitton A, Greenberg GR, Lander ES, Siminovitch KA, Hudson TJ: Genetic variation in the 5q31 cytokine gene...

Ngày tải lên: 11/08/2014, 10:23

... of granulocyte- macrophage colony- stimulating factor (GM -CSF) on hepatitis B vaccination in haemodialysis patients J Viral Hepat 1996, 3(3):149-153 Carlsson T, Struve J: Granulocyte- macrophage colony- stimulating ... macrophagecolony stimulating factor during interruption of HAART AIDS 2003, 17(10):1487-1492 Deresinski SC: Granulocyte- macrophage colony- stimulating factor: potential therapeutic, immunological and ... after recombinant human granulocyte- macrophage colony- stimulating factor (rhGM -CSF) and a single dose of recombinant hepatitis B vaccine Vaccine 1996, 14(13):1199-1204 Hess G, Kreiter F, Kosters...

Ngày tải lên: 11/08/2014, 10:23