governance and accountability a legal approach to auditing

... Emily and Len Brizzi, Gino and Donna Albertario, Vahan Janjigian, Annette and Clint Welch, Don Horenstein, Mark Wachs, John Mihale, Mark and Roberta Aaronson, Rocco Papandrea, Milan Miletic, Maris ... the challenges were overcome thanks to those whom I am proud to call friends and colleagues Many thanks go to Jason and Jane Welsch, Bharath Chandar, Joseph Roccasalvo, George and Andrea Fulop, ... government, and the markets and, thereby, quality original investment research Thanks to the PC and the Net, an investor has at his/her disposal the essential communications and analytical tools to capture...

Ngày tải lên: 28/06/2014, 21:20

... provides insight into potential errors (bias and random error) related to data based on clinical examina- Page of 10 (page number not for citation purposes) Acta Veterinaria Scandinavica 2009, 51:36 ... Page of 10 (page number not for citation purposes) Acta Veterinaria Scandinavica 2009, 51:36 cal analyses in the future, and they are highly motivated to use, for instance, multi-factorial analysis ... scores as a 'diagnostic tool' related to each individual treatment decision rather than being part of a collaborative data collection For example, they could add rectal temperature and other parameters...

Ngày tải lên: 25/10/2012, 10:45

... as we have seen it also has syntactic implications 2.2.2 Gradable and non- gradable adjectives According to L G Alexander (1988, 108) adjectives can be also divided into gradable and non- gradable ... up to now C .A plays an important role in learning a foreign language as a main subject at most language universals According to C James (1980;19), C .A is a form of inter-language study and a central ... semantic and syntactic functions of English adjectives Chapter III is a study to a new approach to semantic and syntactic functions of English adjectives Chapter IV is to make a contrastive analysis...

Ngày tải lên: 10/04/2013, 14:46

... heritage are valued We are Christians and Jews, Appalachians and Easterners, Black and White, men and women, young and old, graduate students and faculty All contribute their own unique and useful ... want to sit in a wheelchair okay So my husband pushed me down to therapy the first day And this big man approached me and said Tm here to help you I'll teach you to walk.' He said, 'You'll stand ... the American Nurses Association, the American Psychological Association, and Sigma Theta Tau International She is a board member of the International Council on Women's Health Issues and a charter...

Ngày tải lên: 16/10/2013, 11:15

... team The database analysts and the programmers are unable to agree on the proper ways to pass information back and forth between the interface and the database, and the requirements analysts and ... software packages), hardware and software implementation (implementing new computers or software), database management and revision (ensuring proper data storage and access), hardware and software ... Project managers usually employ a Responsibility Assignment Matrix (RAM) such as the sample in Table (PMI, 2000), and OD scholars have advocated similar approaches in teambuilding and organizational...

Ngày tải lên: 24/10/2013, 08:20

... the Sandia National Laboratory study on enterprise transformation serves to bring the dangers that managers and administrators face when attempting to impose a transformational change into their ... Defense, and Homeland Security; the Federal Aviation Administrations (FAA); the National Aeronautics and Space Administration (NASA); and the White House Office of Science and Technology to plan the ... the earlier actions are integrated into the organization’s culture The Sandia Laboratories management team, for example, warned that a transformation initiative should not demand more than the...

Ngày tải lên: 15/02/2014, 20:20

... network than before, again including the occipital, temporal, and the frontal lobes, but in particular bilateral orbital frontal corlex What the results of Kawabata and Zeki (2004) and Skov ef al (2005) ... neural correlates of preference and beauty, two variables that have affective and cognitive components The areas activated by Vartanian and Goel (2004b) may have highlighted those cOrlical structures ... contrast, the studies by Kawabata and Zeki (2004) and Skov ef al (2005) attempted to isolate those cortical structures that are actIvated more when a stimulus is evaluated as beautiful Presumably,...

Ngày tải lên: 19/02/2014, 17:20

... identify critical components that are key to success G HAZOP and FMEA approaches Hazard and Operability studies and Failure Modes Effects Analysis are quantitative technical failure analysis techniques ... developed into a set of targets for health and safety performance There is a danger that risk appetite statements fail to be dynamic, and they can constrain behaviour and rapid response At Board level, ... by way of two mechanisms These are monitoring and review of performance and communication and consultation Monitoring and review ensures that the organisation monitors risk performance and learns...

Ngày tải lên: 21/02/2014, 12:20

... Gender-Based Approach , Sexual Health Exchange 1998, no 2, pp 3–6 83 T Valdés and J Olvarríra, eds, “Masculinidades y equidad de genéro en America Latina”  21 Partnering: A New Approach To Sexual And ... me to share with people and to reach out to others and help She taught me that I am a human being first and a man second And that as a man, I should help the women publicly and privately to build ... It called for stronger legislation against all forms of domestic violence, including marital rape and sexual abuse, and against violence towards women and girls as a human rights violation; and...

Ngày tải lên: 05/03/2014, 16:20

... Sao Paolo New York Mumbai (Bombay) Los Angeles Calcutta Shanghai Dhaka Delhi Buenos Aires Jakarta Osaka Rio de Janeiro Karachi Japan Mexico Brazil USA India USA India China Bangladesh India Argentina ... Buenos Aires A Practical Approach to Water Conservation urbanisation and water stress in regions around mega-cities as a ratio of total water withdrawals divided by estimated total availability ... Europe North America Central America North Africa Central and South Asia Middle East Southeast Asia Central Africa South America Southern Africa Oceanania Virtual water trade balances of thirteen...

Ngày tải lên: 06/03/2014, 17:20

... ATGATGAAACGGTTCAAT TTAGTTACCGTGTGCTTC CTGCTGCTCGCAGCAAGT GTGTGATCTGCAACTGTT CACCGAGGAATAATAAATGATG AAACGGTTCAATTTC TTAGTTACCGTGTGCTTC CACCGAGGAATAATAAATGATG AACGCACAAAAATCA TTACATTTTCACTTTAGT OMCA-PBAD-R ... name Sequence (5¢- to 3¢) OMCA-KO-F OMCA-KO-R OMCB-KO-F OMCB-KO-R OMCA-F OMCA-R OMCB-F OMCB-R OMCA-PBAD-F CACACTGCAACCTCTGGT ACTGTCAATAGTGAAGGT CCCCATGTCGCCTTTAGT TCGCTAGAACACATTGAC ATGATGAAACGGTTCAAT ... omcA– mutant, and omcA (lane 7), omcB (lane 8), mtrA (lane 9) and mtrB (lane 10) in the omcB– mutant MR-1R was used as a positive control to display omcA (lane 1) and omcB (lane 6) DNA standards...

Ngày tải lên: 07/03/2014, 09:20

... Conservation and Protection - Corporate Policy Cjroup Health and Welfare Canada National Oceanic and Atmospheric Administration (NOAA), Climate Moniloring and Diagnostic Laboratory, Boulder Colorado, ... health information to create an overall health index of use as an indicator of sustainable development IX APPROACHES TO SUSTAINABLE DEVELOPMENT INDICATORS This report spells out an approach to ... pressure and state indicators How existing economic and social indicators fit into such a framework also appears to be somewhat arbitrary A second approach, proposed by Peter Bartelmus of UNSTAT,...

Ngày tải lên: 15/03/2014, 16:20

... Tuula, Susanna, Katri, and Juha as an integral part of my intellectual welfare I have had the privilege to be able to attend several international conferences, to meet new colleagues, and to see some ... regard to paper manufacturing and the end-uses of paper products as well as in paper recycling Almost as long as man has made paper, first by hand and then industrially, different additives have ... Monografia Yhdistelmäväitöskirja (yhteenveto + erillisartikkelit) Tiedekunta Kemian ja materiaalitieteiden tiedekunta Laitos Puunjalostustekniikan laitos Tutkimusala Puunjalostuksen kemia Vastaväittäjä(t)...

Ngày tải lên: 18/03/2014, 02:20

... 1121-1134, 1999 The second addresses cause -and- effect in cheating and performance: David J Palazzo, Young-Jin Lee, Rasil Warnakulasooriya, and David E Pritchard, Patterns, Correlates, and Reduction of Homework ... why the addresses are the particular values that they are later Each cell is annotated with its associated variable and the type of that variable The type indicates how to interpret the data The ... memory is to initialize variables at declaration: { int a = , b = 0; a = b; } In practice it is not always possible to find reasonable values to which to initialize variables, and one can still...

Ngày tải lên: 19/03/2014, 14:05

... composite restorations -laboratory processed inlays/onlays and veneers Indirect ceramic restorations and alloys that are to be resin-bonded- inlays/onlays Amalgam restorations-if isolation can be achieved ... of care LABORATORY COMMUNICATIONS Many practical methods are available to enhance communication with the dental laboratory Shape and texture can be communicated by intraoral photographs or slides ... York, 1988, Ballantine Books BIBLIOGRAPHY Adams A: Artificial-light photography, Hastings-on-Hudson, 1968, Morgan and Morgan Agoston GA: Color theory and its application in art and design, New...

Ngày tải lên: 22/03/2014, 22:20

... of the main drawbacks of many rewall conguration languages There are some tools that help administrators to build their security policy and to translate it to the actual conguration language (for ... role to dene roles that are relevant in a given organization, (2) Predicate relevant activity(org, a) where org is an organization and a an activity to dene activities that are relevant in a given ... play in the organization We use a similar approach for actions and objects An action is permitted based on the role this action plays in the organization In Or-BAC, an action role is called an...

Ngày tải lên: 28/03/2014, 22:20

... position and date of installation of water and gas mains, electricity and television cables, septic tanks, and soak-aways are essential In areas of settlement it is important to know the date of ... solving crimes and having information about locations that criminals habitually travel to in the areas close to their homes For example, the mental map we draw of an area changes over time, and often ... plants of a given geographical area, a perimeter/location customarily bears a palynological marker endemic to its floral occupants Just as individuals decorate and bring familiar objects into their...

Ngày tải lên: 29/03/2014, 04:20

... component to different stimuli and allow drawing a conclusion about how pathways interact in a dynamical way and how signals are thereby modulated The newly proposed crosstalk measures Si and Se can ... centrifugal elutriation [39] We strongly believe that if we want to understand how pathways interact and crosstalk dynamically, measurements of pathway activation with both pathways being active are ... and the filamentous growth pathway In this study we employ mathematical modelling techniques to analyse dynamic mechanisms and measures of crosstalk We illustrate our approach by giving an example...

Ngày tải lên: 30/03/2014, 10:20

... formal, iterative approach to design and tuning It allows us to reason explicitly about particular design goals, and to anticipate how changes will impact each aspect of the framework and the resulting ... Talking about games and play is hard because the vocabulary we use is relatively limited In describing the aesthetics of a game, we want to move away from words like “fun” and “gameplay” towards ... a more directed vocabulary This includes but is not limited to the taxonomy listed here: Sensation Game as sense-pleasure Fantasy Game as make-believe Narrative Game as drama Challenge Game as...

Ngày tải lên: 30/03/2014, 16:20

... corpora showed that the hybrid method had high accuracy in Chinese and Japanese 220 References Taku Kudo, Kaoru Yamamoto, and Yuji Matsumoto 2004 Applying Conditional Random Fields to Japanese ... and showed that character-based approaches had higher accuracy than word-based approaches, and that conducting word segmentation and POS tagging all at once performed better than 218 conducting ... word and character-based combined approach on Japanese corpora We next compare performance of word segmentation alone The F-measures of the hybrid method were again highest in all the corpora, and...

Ngày tải lên: 31/03/2014, 01:20