god is nothing but a projection of our imagination

... down to half a bag of rice” = “chúng tơi n a bao gạo” Thơng thường bạn nói số lượng vật/ đồ vật bị giảm, bạn liệt kê như: Now it’s down to just me, Claire, and Maria - Hiện tơi, Claire Maria Lưu ... Với viết Daily English Speaking Lesson này, cho hiểu ro cách sử dụng " is down to " giao tiếp thường ngày Hãy xem thực hành cho ! “We’re down to only people now.” Công ty bạn v a gặp phải chút ... Phần lớn nhân viên phận bạn bị sa thải Và có bạn, sếp bạn nhân viên Bạn nói chuyện với bạn tình “We’re down to only people now” (something) is down to (a number of something) Khi có nhiều từng,...

Ngày tải lên: 10/03/2014, 11:20

... rule and less squeamish about the means, was John Strachan, afterwards Bishop of Toronto Educated a Presbyterian, he had come to Canada from Aberdeen as a dominie but had remained as an Anglican ... sea the capture of the Chesapeake by the Shannon salved the pride of England The last year of the war was also a year of varying fortunes In the far West a small body of Canadians and Indians ... War of 1812 was James Stuart, the son of the leading Anglican clergyman of his day, but he soon fell away and became a mainstay of the bureaucracy His brother Andrew, however, kept up for many...

Ngày tải lên: 22/03/2014, 18:20

... FXI-deficient plasma as substrate (Hemoliance, Salt Lake City, UT) FXI antigen was measured by an ELISA based on a goat anti-human FXI affinity purified IgG as capture antibody and a goat antihuman FXI ... aliquot of the activation solution was taken to measure the Michaelis parameters of S-2366 hydrolysis by FXIa The Michaelis parameters, kcat and Km, were calculated on the basis of known concentration ... haemophilia B families Br J Haematol 89, 409–412 Maekawa H, Sugo T, Yamashita N, Kamiya K, Umeyama H, Miura N, Naka H, Nishimura T, Yoshioka A & Matsuda M (1993) Molecular defect in factor IX...

Ngày tải lên: 23/03/2014, 07:20

... the data analysis Hiroshi Nagata and Hiroshi Tanaka supervised several versions of the manuscript All authors read and approved the final manuscript Page of 19 Sawada A: The nurse shortage problem ... stratified by sex and age (2008) Page of Table Comparison of numbers of graduates and medical student quota six years earlier Year Student quota years earlier Number of Graduates Graduation Rate 2000 ... Japanese Journal of Population 2008, 6:76-114 13 Statistics and Information Department, Minister’s Secretariat, Ministry of Health, Labour and Welfare: Survey of Physicians, Dentists and Pharmacists...

Ngày tải lên: 18/06/2014, 17:20

... Understanding Outcome AFFORDANCE An affordance is a quality of an object, or an environment, that allows an individual to perform an action AFFORDANCE SEMIOTICS The study of signs offering an explanation ... hierarchies, create bonds between elements, add pace or emotion COLOUR THINK SMARTER PART TWO AND SO TO WEB OUR VISUAL GRAMMAR OUR MISTAKES UNIQUE PATTERNS AND INTERACTIONS EVOLUTION OF THE FRAME ... explanation of how people extract meaning from words, sounds and images SEMIOTICS Symbol Icon Index TYPOGRAPHY By using typography we give a written idea a visual form TYPOGRAPHY COLOUR Colour can...

Ngày tải lên: 21/07/2014, 10:28

... with CLL Caspase activation, PARP cleavage and DNA fragmentation Exposure of WSU-FSCCL cells to TW-37 induced activation of caspase and caspase activity and PARP cleavage Page of 13 (page number ... lymphoma cells and established cell lines to TW-37 was associated with activation of caspase and 9, cleavage of the polyadenosine ribose polymerase (PARP) into active fragments and DNA fragmentation ... by Ascenta Therapeutics Inc University of Michigan and Shaomeng Wang own equity in Ascenta Shaomeng Wang also serves as a consultant for Ascenta and is the principal investigator on a research...

Ngày tải lên: 10/08/2014, 22:20

... basic aim is not abandonment but to restore the disabled person to a state that is as near normality as possible80 In fact, the evocation of disability as a personal tragedy is at the heart of ... construction of disability and made their voices heard The activism and agency of the disabled meant that this move towards a new discourse of disability was one in which the disabled shared in That is ... unrehabilitated disabled person was a tragedy.77 He added that the rehabilitation of the 73 E Marland and Chislain Moureaux, Marland's & Moureaux's reports on the vocational rehabilitation of the...

Ngày tải lên: 26/09/2015, 10:51

... earlier diagnosis of cancer a major focus and to act as a catalyst for action We are co-chairing the National Awareness and Early Diagnosis Initiative (NAEDI), which brings together a wide range of ... needs of our research strategy, particularly in terms of encouraging autonomy and innovation and reducing bureaucracy • Streamline our application process and award management systems • Identify and ... DNA damage leads to cancer, mechanisms of cellular DNA repair, immune system and inflammatory responses to cancer, invasion and metastasis and genetic pre-disposition to cancer Scientists at Cancer...

Ngày tải lên: 22/03/2014, 16:21

... journal but we feel the research climate and resources are now supportive of these types of challenges Well-being research has increased substantially over the past decade and the demand to disseminate ... neurobiological markers of well-being The accomplishments to date have been substantial and there is promise of ongoing and even more innovative progress with the high calibre of scholars currently dedicated ... well-being research, many of whom we are fortunate to have on our editorial board Several of the major achievements occurring over the past decade were facilitated by the formation of “positive...

Ngày tải lên: 21/06/2014, 06:20

... analysis ELISA and myeloperoxidase assay measurements KL-6 was measured by ELISA (Eisai Corporation, Tokyo, Japan) according to the manufacturer's instructions in BALF and in plasma The intra-assay ... indicator of interstitial pneumonitis activity Sialylated carbohydrate antigen KL-6 Chest 1989, 96:68-73 Ishizaka A, Matsuda T, Albertine KH, Koh H, Tasaka S, Hasegawa N, Kohno N, Kotani T, Morisaki ... N, Awaya Y, Oyama T, Yamakido M, Akiyama M, Inoue Y, Yokoyama A, Hamada H, Fujioka S, Hiwada K: KL-6, a mucin-like glycoprotein, in bronchoalveolar lavage fluid from patients with interstitial...

Ngày tải lên: 13/08/2014, 10:20

... dead (John Naisbitt) We know that people have nothing against change per se Just against the fact of „being“ changed For that reason we pay special attention in change process that each team ... behaviour characterizes our rational and decision making process We believe in being available for each other 24 x and communicating with each other actively Our Sun-down rule says, that all ... Specific, Measurable, Ambitious, Realistic and have a Time target We are a process driven organization If any team member recognizes a flaw in a process, it is her/his duty to improve it until it is solved...

Ngày tải lên: 17/10/2013, 01:15

... onset of World War II and a number of internal scandals once again laid the Klan low Public sentiment turned against the Klan as the unity of a country at war trumped its message of separatism But ... within a few years, there were already signs of a massive revival As wartime anxiety gave way to postwar uncertainty, Klan membership flourished Barely two months after V-J Day, the Klan in Atlanta ... his own anti-Klan activities but those of another man, code-named John Brown Brown was a union worker and a former Klan of cial who had changed his ways and offered to infiltrate the Klan It was...

Ngày tải lên: 17/10/2013, 18:20

... only a representative sampling from a larger number of such registrations revealed by his search Ser No 75/934,127 Applicant filed a Notice of Appeal with the Trademark Trial and Appeal Board, along ... its application are completely unrelated to those set forth in the registration cited as a bar to registration of applicant’s mark The Examining Attorney was not persuaded by applicant’s arguments, ... listed in the registration cited as a bar to the registration of the mark applicant seeks to register Nine such third-party registrations were included, but the Examining Attorney stated that...

Ngày tải lên: 20/12/2013, 23:15

... within a scene have the same color temperature A combination of filters and electronic adjustments is used to adapt color cameras to each new lighting situation Most cameras can adjust automatically ... an ordinary candle one foot away from a white square on a black background I tested two cameras The first was a popular CCD camera requiring four LUX for minimum illumination The second was a ... or black level, of zero IRE, rather than the 7.5 IRE broadcast standard Some cameras that automatically boost the signal in low light situations can also be run in manual mode where you can control...

Ngày tải lên: 26/01/2014, 04:20

... English is difficult and it’s hard to memorize new words ðeɪ θɪŋk ˈɪŋ ɡlɪʃ ɪz ˈdɪfɪk əlt ænd ɪts hɑːrd tə ˈmem ə raɪz njuː wɜːdz and grammatical rules In fact, learning English can be a piece of ... ˈeɪʃ ən doʊnt ˈ wɝːɪ ə ˈbaʊt ˈɡræm ə Don’t be afraid of making mistakes Just try to speak doʊnt biː ə ˈfreɪd ʌv ˈmeɪk ɪŋ mɪ ˈsteɪk dʒʌst traɪ tuː spiːk Speak English as much as possible spiːk ˈɪŋ ...  In fact, she is a sales person! “Improve” = cải thiện, cải tiến I want to improve my English! Many people are worried about learning English ˈmen i ˈpiːpl ɑːr ˈwʌrid ə ˈbaʊt ˈlɝːn ɪŋ...

Ngày tải lên: 27/01/2014, 20:11

... program An alternative to either of these is the International Baccalaureate (IB) and a small number of schools, mainly private, offer the IB diploma Table reports some standard VCE statistics across ... (bas) It is a group of schools in Ballarat, that provides the basis for interschool sporting competition Ballarat and Clarendon College; Ballarat and Queens Anglican Grammar School; Ballarat ... English Attendance ICSEA Number of Teachers Number of Support Staff Read7 Write7 Spell7 Grammar7 Math7 School Associations: ASPV AGSV GV ACC ACOED BAS CAS Sandhurst EID GIS SIS Region: Cental East...

Ngày tải lên: 20/02/2014, 19:20

... TCAGAGTTCCCTACCGAAGCAG MH181PO.F: CTCCAAGCAGATGCAGCAGA M225PO.P: CCGTGGTGCTGATGGGCAAGAA M267PO.R: ACCATGATGCGCAAGGCCAT 1584p21.F: GTACAAGGAGCCAGGCCAAG 1629p21.P: TCACAGGACACTGAGCAATGGCTGATC 1691p21.R: ... CGCACTGTAAGACCCCAACA 6mC9.F: TCTGCACCCTCACCGTCTTC 58mC9.P: TCTCGAAGATATGACTCCAGGACCACAATATTTTCT 135mC9.R: GGCTTCCATGGCATACTCCA 616mCARP.F: CTTGAATCCACAGCCATCCA 641mCARP.P: CATGTCGTGGAGGAAACGCAGATGTC 706mCARP.R: ... 423mMLCfast.P: ACCGATTTTCCCAGGAGGAGATCAAGAA 500mMLCfast.R: TCTTGTAGTCCACGTTGCCG 381mMLC-2V.F: GAAGGCTGACTATGTCCGGG 403mMLC-2V.P: ATGCTGACCACACAAGCAGAGAGGTTCTC 461mMLC-2V.R: GCTGCGAACATCTGGTCGAT 958mMurf1.F...

Ngày tải lên: 07/03/2014, 03:20

... with a pKa of 7.5 [11] to achieve catalysis, a common feature in hydrolytic metalloenzymes [12] One residue that appears to take part in catalysis in HsSTP is His62, which may act as a general acid ... Superimposition of monomers A and C of SaSTP, and MtSTP monomer A [9] Monomer C of SaSTP is magenta as in Fig 2A, monomer A is blue and MtSTP is gray Metal ions and nucleophilic water molecules are shown as ... residues to Asp118 and Asp191 in HsSTP (Asp146 and Asp239) and, of course, in SaSTP (Asp118 and Asp192) Our SaSTP crystal structure provides clear evidence that the flap subdomain is a mobile element...

Ngày tải lên: 07/03/2014, 09:20

... have been reported to act as phytotoxins [e.g cerato-platanin of Ceratocystis fimbriata f sp platani, Snodprot1 of Phaeosphaeria nodorum and Sp1 of Leptosphaeria maculans) or human allergens and ... pathogenesis-related proteins (As-CG of Coccidioides immitis, Aca1 of Antrodia camphorata and Aspf13 of Aspergillus fumigatus) It should be noted that a low similarity of H atroviridis Epl1, but ... generation of the EST database, and especially Patrizia Ambrosino and Luis Sanz for providing purified cell walls of plant pathogenic fungi The authors also wish to thank Christian Gamauf for his...

Ngày tải lên: 07/03/2014, 12:20