glycoprotein fetuin a is a systemic inhibitor of unwanted calcification
Báo cáo khoa học: Insulin is a kinetic but not a thermodynamic inhibitor of amylin aggregation pot
... trifluoroacetic acid Absorbance was measured at 280 nm, and the flow rate was 0.3 mL ⁄ Statistical analysis Data from three independent experimental groups are presented as mean values ± standard deviation ... concentration of insulin showed more significant inhibitory and promotional effects on amylin aggregation In the SEC analysis (Fig 6), the peak of insulin supernatant almost disappeared after 48 h of ... the major part of islet amyloid, may possibly be formed by more complicated mechanisms However, insulin may still act as a contributor to amyloid formation in pancreatic islets and lead to a repetitive...
Ngày tải lên: 23/03/2014, 04:21
Báo cáo khoa học: The leech product saratin is a potent inhibitor of platelet integrin a2b1 and von Willebrand factor binding to collagen pdf
... molecules, LAPP (an approximately 13 kDa leech antiplatelet protein isolated from Haementeria of cinalis) and calin and saratin (approximately 65 kDa and 12 kDa proteins, respectively, both isolated ... hematophagy The presence of anticoagulants in the salivary glands of the leech, Hirudo medicinalis, was originally discovered by Haycraft in 1884 and led to the isolation of hirudin, a potent antithrombin ... dose–response and maximal aggregation of platelets did not differ in the presence of saratin (data not shown) However, onset of aggregation was significantly delayed in the presence of saratin (Fig 1A) , and...
Ngày tải lên: 30/03/2014, 09:20
Báo cáo sinh học: " Chloroquine is a potent inhibitor of SARS coronavirus infection and spread" pptx
... infections Many novel therapeutic approaches have been evaluated in laboratory studies of SARS-CoV: notable among these approaches are those using siRNA [7], passive antibody transfer [8], DNA vaccination ... syndrome (SARS) coronavirus by a human mAb to S1 protein that blocks receptor association Proc Natl Acad Sci USA 2004, 101:2536-2541 Savarino A, Boelaert JR, Cassone A, Majori G, Cauda R: Effects of ... Rennekamp AJ, Amberg SM, Piefer AJ, Bates P: Characterization of severe acute respiratory syndromeassociated coronavirus (SARS-CoV) spike glycoproteinmediated viral entry Proc Natl Acad Sci USA 2004,...
Ngày tải lên: 19/06/2014, 08:20
Báo cáo hóa học: " Iota-Carrageenan is a potent inhibitor of rhinovirus infection" docx
... a variation of titers of HRV strains tested However the anti-viral activity of Iota- Carrageenan was comparable in all tested HNep batches (data not shown) Our data on primary cells are consistent ... properties In particular sulphated polysaccharides including Carrageenan, a sulphated polysaccharide extracted from red seaweed has an excellent safety profile and has shown anti-viral efficacy against ... report an anti-viral efficacy of different sulphated polysaccharides including Iota-Carrageenan against several animal viruses Iota-Carrageenan showed anti-viral activity against the enveloped...
Ngày tải lên: 20/06/2014, 01:20
báo cáo hóa học:" Chloroquine is a potent inhibitor of SARS coronavirus infection and spread" docx
... infections Many novel therapeutic approaches have been evaluated in laboratory studies of SARS-CoV: notable among these approaches are those using siRNA [7], passive antibody transfer [8], DNA vaccination ... syndrome (SARS) coronavirus by a human mAb to S1 protein that blocks receptor association Proc Natl Acad Sci USA 2004, 101:2536-2541 Savarino A, Boelaert JR, Cassone A, Majori G, Cauda R: Effects of ... Rennekamp AJ, Amberg SM, Piefer AJ, Bates P: Characterization of severe acute respiratory syndromeassociated coronavirus (SARS-CoV) spike glycoproteinmediated viral entry Proc Natl Acad Sci USA 2004,...
Ngày tải lên: 20/06/2014, 04:20
Báo cáo y học: " Peptide P5 (residues 628–683), comprising the entire membrane proximal region of HIV-1 gp41 and its calcium-binding site, is a potent inhibitor of HIV-1 infection" pptx
... biophysical studies and neutralization assays, and drafted the manuscript DT participated to the neutralization and binding assays AA participated in the design of the study and writing of the manuscript ... using a Jasco CD spectrophotometer (Jasco, Japan) with a cell path length of 0.05 cm Spectra were collected as an average of three scans, with a scan speed of 20 nm/min and a response time of sec ... displayed a positive peak after 195 nm and two negative maxima at 208 nm-222 nm, characteristic of α-helices (Figure 2) Quantification of the α-helical content of these peptides indicated that...
Ngày tải lên: 13/08/2014, 05:21
Báo cáo khoa học: Epidermal growth factor receptor-regulated miR-125a-5p – a metastatic inhibitor of lung cancer potx
... metastasis G Wang et al against ERK1 ⁄ and phospho-ERK1 ⁄ were from Chemicon International, Inc (CA, USA) Antibody against Akt was from BioVision, Inc (CA, USA), and antibody against phospho-Akt was from ... Hangzhou, China) b-Actin (Anti-beta-Actin Monoclonal Antibody; MultiSciences Biotech Co., Ltd, Hangzhou, China) was used as a positive control RNA isolation and miRNA microarray On the day after subculturing, ... Cells and cultures The human lung cancer cell line A5 49 was obtained from the American Type Culture Collection (Manassas, VA, USA) and maintained in Ham’s F12K medium (Invitrogen, Carlsbad, CA,USA)...
Ngày tải lên: 07/03/2014, 00:20
Báo cáo khoa học: A novel inhibitor of indole-3-glycerol phosphate synthase with activity against multidrug-resistant Mycobacterium tuberculosis pptx
... GACCTCATGACGGCGGACGTGGACCG Down: CGGTCCACGTCCGCCGTCATGAGGTC Ser64 fi Ala Glu168 fi Ala Val169 fi Ala His170 fi Ala Asn189 fi Ala Arg191 fi Ala Asp192 fi Ala Leu193 fi Ala Leu196 fi Ala The concentrations of ... Up: CACTCGTCGAGGCCCATACCGAGCAG Down: CTGCTCGGTATGGGCCTCGACGAGTG Up: CGTCGAGGTCGCTACCGAGCAGGAAG Down: CTTCCTGCTCGGTAGCGACCTCGACG Up: GGTGATTGGCGTTGCCGCCCGCGACC Down: GGTCGCGGGCGGCAACGCCAATCACC ... Ala Up: CAAGCGCGCTAGTGCTTCGGCAGGCG Down: CGCCTGCCGAAGCACTAGCGCGCTTG Up: CGCTAGTCCTGCGGCAGGCGCATTGG Down: CCAATGCGCCTGCCGCAGGACTAGCG Up: CAGCACTCGTCGCGGTCCATACCGAG Down: CTCGGTATGGACCGCGACGAGTGCTG...
Ngày tải lên: 07/03/2014, 03:20
Báo cáo khoa học: " A specific inhibitor of protein kinase CK2 delays gamma-H2Ax foci removal and reduces clonogenic survival of irradiated mammalian cells" pot
... incubated for repair prior to lysis Data analysis involved quantification of the fraction of total DNA mass in electrophoretically mobile DNA fragments (FR-values) by means of ethidium bromide DNA ... treatment condition) before calculating the displayed mean values (and standard deviations) from at least independent determinations localized and transient changes of chromatin organization that ... of DNA damage response decay from break ligation Acknowledgements The authors wish to thank Ute Haner and Sylvia Trinh for their excellent technical assistance Author details Department of Radiation...
Ngày tải lên: 09/08/2014, 09:20
Báo cáo y học: "Analysis of TNFAIP3, a feedback inhibitor of nuclear factor-κB and the neighbor intergenic 6q23 region in rheumatoid arthritis susceptibility" pot
... study and in the coordination of acquisition of clinical data and collection of samples, and supervised genotyping, statistical analysis, interpretation of results and writing of the manuscript All ... interpretation of results JJG-R coordinated the acquisition of clinical data and collection of samples, and participated in the analysis and interpretation of results AG participated in the design of ... SNP, and vice versa) [see Table S3 in Additional data file 1] This finding suggests that association is due to a causal polymorphism that is tagged by some haplotypes containing the T allele of...
Ngày tải lên: 09/08/2014, 14:20
Báo cáo y học: " Arsenic trioxide, a potent inhibitor of NF-κB, abrogates allergen-induced airway hyperresponsiveness and inflammation" pot
... Rockford, IL) according to the manufacture's instructions Data analysis Statistical analysis was performed by one-way analysis of variance (ANOVA) and q test with SPSS 11.0 software package (SPSS ... cardinal feature that underlies asthma, signifying a potential dissociation between airway inflammation and AHR [29] Clearly, additional airway signaling pathways activated, residual NF-κB activity ... of AHR by As2O3 Penh, relative to the measured airway resistance, was obtained as an index and was normalized to the postsaline – Penh This readout was used as a measure of AHR http://respiratory-research.com/content/7/1/146...
Ngày tải lên: 12/08/2014, 16:20
Nucleophosmin as a direct inhibitor of caspase 6 and 8
... 3501.0 Mass (m/z) maarvlvigs ggrehtlawk laqspqvkqv lvapgnagta gagkisnaav svndhsalaq 61 fckdekielv vvgpeaplaa givgdltsag vrcfgptaqa aqlesskkfa kefmdrheip 121 taqwraftnp edacsfitsa nfpalvvkas glaagkgviv ... Fwu-shan, Associate Professor Leung Ka Yin, Associate Professor Gong Zhiyuan, Associate Professor Wang Shu, Assistant Professor Lim Kah Leong, Assistant Professor Low Boon Chuan, Assistant Professor ... Venkatasubbarao, 2004) It usually begins with a subset of proteins sharing a common trait (e.g affinity for a particular small molecule), isolated from a starting material Chapter I Proteomic analysis of...
Ngày tải lên: 16/09/2015, 08:30
Tài liệu Báo cáo khoa học: Bacitracin is not a specific inhibitor of protein disulfide isomerase pptx
... A. -R Karala and L W Ruddock bacitracin contains at least nine different peptides, of which bacitracin A is the most abundant, and it is mainly used as an antibiotic against infections caused ... thiol–disulfide exchange enzymes, Escherichia coli DsbA and DsbC, as well as the isolated catalytic a domain of PDI Both the PDI a domain and DsbA have a catalytic site, with an associated substrate-binding ... increase the rate of aggregation However, the rate of aggregation in the noncatalyzed refolding of rhodanese was also decreased by bacitracin The decrease in the noncatalyzed rate (31%) was similar...
Ngày tải lên: 16/02/2014, 14:20
Báo cáo hóa học: " Sargassum fusiforme fraction is a potent and specific inhibitor of HIV-1 fusion and reverse transcriptase" pot
... microglia, and astrocytes by Sargassum fusiforme AIDS Res Ther 2006, 3:15 Hoshino T, Hayashi T, Hayashi K, Hamada J, Lee JB, Sankawa U: An antivirally active sulfated polysaccharide from Sargassum ... NCI-Frederick), and was also quantified for titers of infectious virus by multinuclear activation of a β-galactosidase indicator (MAGI) assay [20] Culture supernatants contained to µg of viral p24 protein ... experiments 16 Acknowledgements We wish to thank K Thornber and T Havens for translation of Japanese Sargassum literature, and Dr Carlos de Noronha for discussion and useful comments This work was supported...
Ngày tải lên: 20/06/2014, 01:20
Báo cáo y học: "Natural killer cell dysfunction is a distinguishing feature of systemic onset juvenile rheumatoid arthritis and macrophage activation syndrome" pot
... preparation EHG carried out statistical analysis and manuscript preparation TBG carried out patient referral, clinical data analysis and manuscript preparation MHP carried out patient referral, ... the diagnosis of JRA was established on the basis of the American College of Rheumatology (ACR) diagnostic criteria [18] The main clinical characteristics of the patients are summarized in Table ... role of NK cells in autoimmune disease Autoimmunity 2002, 35:1-14 29 Yabuhara A, Yang FC, Nakazawa T, Iwasaki Y, Mori T, Koike K, Kawa H, Komiyama A: A killing defect of natural killer cells as an...
Ngày tải lên: 09/08/2014, 06:22
Báo cáo y học: "Excess circulating angiopoietin-2 is a strong predictor of mortality in critically ill medical patients"
... Minneapolis, USA) This assay measures biologically active VEGF121 and VEGF165 Statistical analysis Differences between patients and healthy controls were evaluated using a non-parametric Kruskal-Wallis test ... Critical Care Vol 12 No Kümpers et al package (SPSS Inc., Chicago, IL, USA) and the GraphPad Prism software (GraphPad Prism Software Inc San Diego, California, USA) Figure Results Decreased Ang-1 and ... optimal cut-off values Data are displayed as median and range (minimum to maximum) unless otherwise stated All statistical analyses were performed with the SPSS Page of (page number not for citation...
Ngày tải lên: 25/10/2012, 10:31
Báo cáo y học: "Eosinopenia is a reliable marker of sepsis on admission to medical intensive care units"
... 51:189-197 A ssaoui Y, Zeggwagh AA, Zekraoui A, Abidi K, Abouqal R: Validation of a behavioral pain scale in critically ill, sedated, and mechanically ventilated patients Anesth Analg 2005, 101:1470-1476 ... diagnosis of sepsis on admission to the ICU Eosinopenia may become a helpful clinical tool in ICU practices interpretation of data, and gave the final approval of the manuscript All authors read ... of data NM helped to draft the manuscript, and participated in the acquisi- Page of 10 (page number not for citation purposes) tion of data AZ participated in the coordination of the study AAZ...
Ngày tải lên: 25/10/2012, 10:35
Báo cáo y học: "A Randomized Study of Epithelial Ovarian Cancer: Is Chemotherapy Useful after Complete Remission"
... was encountered, as well as in cases of important hypacusia or neurotoxicity or in patients over 76 years of age Statistical comparison of overall and disease-free survival was based on Kaplan-Meier ... Chemotherapy and Surgical Staging in EarlyStage Ovarian Carcinoma: European Organisation for Research and Treatment of Cancer–Adjuvant ChemoTherapy in Ovarian Neoplasm Trial J Natl Cancer Inst ... Bertelsen K, Jakobsen A, Stroyer I, et al A prospective randomized comparison of and 12 cycles of Cyclophosphamide, Adriamycin and Cisplatin in advanced epithelial ovarian cancer: a Danish ovarian study...
Ngày tải lên: 03/11/2012, 09:57
In order to become competent in a foreign language, it is important for language learners not only to acquire new vocabularies and a new set of phonological and syntactic rules but also to learn what Wilson (1986)
... ngữ Nam Bộ Như vậy, không gian đ a lí tiếng miền Nam, phương ngữ miền Nam hay phương ngữ Nam tác giả xác đònh rộng Không gian đ a lí phương ngữ Nam Bộ xác đònh hẹp Ranh giới PNNB trùng với ranh ... (từ thû ấy/ đến nay), thû (từ thû ấy/ đến giờ) V a rút gọn v a đảo trật tự câu nghi vấn tính chất, đặc điểm: bao cao (cao bao nhiêu), bao dai (dài bao nhiêu), bao lớn (lớn bao nhiêu)… Rút gọn, ... Long An, Tiền Giang, An -18- Giang, Kiên Giang, Cà Mau, Sóc Trăng, Bạc Liêu, Đồng Tháp, Bến Tre, Hậu Giang, Vónh Long, Trà Vinh thành phố Cần Thơ Vò trí đ a lí Nam Bộ: ph a bắc tây - bắc giáp Cam-pu-chia,...
Ngày tải lên: 17/04/2013, 16:09