glue code and a worker function to the add button

Báo cáo toán học: " An introduction to 2-fuzzy n-normed linear spaces and a new perspective to the Mazur-Ulam problem" docx

Báo cáo toán học: " An introduction to 2-fuzzy n-normed linear spaces and a new perspective to the Mazur-Ulam problem" docx

... Misiak [3], a Kim and Cho [4], and Malˇeski [5] developed the theory of n-normed c space In [6], Gunawan and Mashadi gave a simple way to derive an (n−1)-norm from the n-norms and realized that any ... An introduction to 2-fuzzy n-normed linear spaces and a new perspective to the Mazur–Ulam problem Choonkil Park1 and Cihangir Alaca∗2 Department of Mathematics, Research Institute for Natural ... Bag and Samanta [8] and also gave some fundamental properties of this space In 1932, Mazur and Ulam [11] proved the following theorem Mazur–Ulam Theorem Every isometry of a real normed linear...

Ngày tải lên: 20/06/2014, 21:20

39 371 0
An investigation into students’ conversational needs and some suggestions for a speaking syllabus to the 2nd year english bachel

An investigation into students’ conversational needs and some suggestions for a speaking syllabus to the 2nd year english bachel

... notional and functional - and those we take a balanced, multidimensional approach to syllabus design In addition, due to the discussion 19 about good points and bad points of approaches to syllabus ... approaches the learner as a user of language rather than as a learner of language 1.2.3.3 A learning centered approach According to Hutchinson and Water (1987:72), “we would reject the term a ... the teachers of the objective they have to reach at the end of each unit and to encourage teachers to find suitable teaching methods Objectives, at the same time, enable teachers to arrange appropriate...

Ngày tải lên: 07/09/2013, 13:19

43 591 1
Tài liệu The Contribution of Sexual and Reproductive Health Services to the Fight against HIV/AIDS: A Review pptx

Tài liệu The Contribution of Sexual and Reproductive Health Services to the Fight against HIV/AIDS: A Review pptx

... of the cervix, vagina, anal and genital area, and a higher incidence of cervical intraepithelial neoplasia (CIN) and advanced cervical disease, and at younger ages, than women in the general ... preventing and managing HIV infection through the use of family planning and dual protection, safe antenatal and delivery care, and STI prevention and treatment  Antenatal care, child health care and ... during antenatal care is now available in many countries, and since treatment for PMTCT became feasible and affordable, there appears to be increasing demand, especially in sub-Saharan Africa.75...

Ngày tải lên: 13/02/2014, 15:20

23 719 0
Báo cáo khoa học: Coordination of three and four Cu(I) to the a- and b-domain of vertebrate Zn-metallothionein-1, respectively, induces significant structural changes doc

Báo cáo khoa học: Coordination of three and four Cu(I) to the a- and b-domain of vertebrate Zn-metallothionein-1, respectively, induces significant structural changes doc

... without reappearance of any new signals was the result of Cu(I) to polypeptide stoichiometries higher than five Taken together, the initial additions of Cu(I) to each domain caused the disappearance ... domain adapts to host the additional copper(I) ions by opening up and rearranging its N- and C-terminal parts, minimizing the structural perturbation of its central part The arrangement of the ... kPa For the a- domain, an average molecular mass of 3021.3 Da (3021.7 Da, theoretical) was observed, calculated from the detected [M + 5H]5+ and [M + 4H]4+ quasi molecular ions at m ⁄ z 605.2 and...

Ngày tải lên: 07/03/2014, 09:20

14 485 0
Báo cáo khoa học: A kinetic approach to the dependence of dissimilatory metal reduction by Shewanella oneidensis MR-1 on the outer membrane cytochromes c OmcA and OmcB potx

Báo cáo khoa học: A kinetic approach to the dependence of dissimilatory metal reduction by Shewanella oneidensis MR-1 on the outer membrane cytochromes c OmcA and OmcB potx

... ACTGTCAATAGTGAAGGT CCCCATGTCGCCTTTAGT TCGCTAGAACACATTGAC ATGATGAAACGGTTCAAT TTAGTTACCGTGTGCTTC CTGCTGCTCGCAGCAAGT GTGTGATCTGCAACTGTT CACCGAGGAATAATAAATGATG AAACGGTTCAATTTC TTAGTTACCGTGTGCTTC CACCGAGGAATAATAAATGATG ... CACCGAGGAATAATAAATGATG AACGCACAAAAATCA TTACATTTTCACTTTAGT OMCA-PBAD-R OMCB-PBAD-F OMCB-PBAD-R 3736 controlled by an arabinose promoter [26], was achieved as visualized by heme staining of SDS ⁄ PAGE ... omcA– mutant, and omcA (lane 7), omcB (lane 8), mtrA (lane 9) and mtrB (lane 10) in the omcB– mutant MR-1R was used as a positive control to display omcA (lane 1) and omcB (lane 6) DNA standards...

Ngày tải lên: 07/03/2014, 09:20

11 732 0
Báo cáo Y học: The unorthodox histidine kinases BvgS and EvgS are responsive to the oxidation status of a quinone electron carrier ppt

Báo cáo Y học: The unorthodox histidine kinases BvgS and EvgS are responsive to the oxidation status of a quinone electron carrier ppt

... nonradioactive ATP were added After the addition of Q-0 and/ or ATP samples were taken immediately and after 0.5, 1, 2, 4, 8, 16 and 32 min; the reaction was stopped by the addition of sample buffer The half-life ... a cell, and it was recently shown that they can bind small ligands such as FAD and ATP [13,29,31] In fact, mutations in this domain have been reported which cause either the inactivation of the ... example, it is known that high aeration and logarithmic growth of the bacteria leads to a predominance of Q-8, whereas under anaerobic conditions and in stationary phase MK-8 is the predominant...

Ngày tải lên: 17/03/2014, 23:20

6 422 0
Testing Costs and Testing Capacity According to the REACH Requirements – Results of a Survey of Independent and Corporate GLP Laboratories in the EU and Switzerland potx

Testing Costs and Testing Capacity According to the REACH Requirements – Results of a Survey of Independent and Corporate GLP Laboratories in the EU and Switzerland potx

... bound and compared to our capacity figures very low We have summarized the average and maximum testing capacity in appendix The ratio of the maximum capacity to the average capacity available is about ... incorporates all the relevant data However, there is no general standard for an acceptable level of price variability Thus, we had to fix a reasonable boundary The ratio mean to median of a sample ... provide analytical backup for all these studies at the same speed as the in vivo part of the study and their capacity to this currently would depend on the availability of the methods and the ease...

Ngày tải lên: 23/03/2014, 05:22

19 493 1
LUẬN VĂN " A THESIS SUBMITTED TO THE GRADUATE SCHOOL OF NATURAL AND APPLIED SCIENCES OF MIDDLE EAST TECHNICAL UNIVERSITY " pot

LUẬN VĂN " A THESIS SUBMITTED TO THE GRADUATE SCHOOL OF NATURAL AND APPLIED SCIENCES OF MIDDLE EAST TECHNICAL UNIVERSITY " pot

... glass formation and the amount of the atomic size mismatch in binary alloys by the following equation: C = (R B / R A ) −1 (2.5) where RA and RB are radii of the solvent atom A and solute atom ... deviation of that fluid from an Arrhenius behaviour and takes values between and 100 [40] The liquids with a fragility parameter smaller than 10 are classified as “fragile” According to the available ... by these rules and conduct, I have fully cited and referenced all material and results that are not original to this work Name, Last name: Sultan Aybar Signature iii : ABSTRACT SOLIDIFICATION AND...

Ngày tải lên: 29/03/2014, 11:20

140 552 0
Báo cáo khoa học: "A concurrent approach to the automatic extraction of subsegmental primes and phonological constituents from speech" docx

Báo cáo khoa học: "A concurrent approach to the automatic extraction of subsegmental primes and phonological constituents from speech" docx

... both the initial fricative and the final plosive at Stage Again, it may be possible to identify a unique word candidate at the end of Stage 2, but if several candidates are available, recognition ... and standard code for FFT as in a spectrogram display object Users may add words using a keypad labelled with IPA symbols Manner class sequences and constituent structure are generated automatically ... defining a quadratic discriminant based on the variance-covariance Figure Stagewise cue invocation strategy This launches the calculation of cues 4)5 (for the automatic segmentation process) and 4)6...

Ngày tải lên: 31/03/2014, 04:20

5 337 0
WHAT IS BETA GLUCAN? A Concise Guide to the Benefits and Uses of the Most Powerful Natural Im- mune Enhancer Known to Science ppt

WHAT IS BETA GLUCAN? A Concise Guide to the Benefits and Uses of the Most Powerful Natural Im- mune Enhancer Known to Science ppt

... this to the usual oatmeal for breakfast and barley soup Steamed barley can be eaten instead of brown rice Oat flour can be added to bread Various hot and cold breakfast cereals contain barley and ... bound to radioactive dye and the course of action was following after oral administration to mice The macrophages took up the glucans, and then transported them to the spleen, lymph glands, and ... oral and parenteral administration of oat beta glucan and these enhanced responses may play an important role in providing resistance to bacterial and parasitic infection Current pharmacological...

Ngày tải lên: 31/03/2014, 22:20

51 527 3
reasons of identity a normative guide to the political and legal assessment of identity claims nov 2009

reasons of identity a normative guide to the political and legal assessment of identity claims nov 2009

... Canada, Australia, New Zealand, and the United States have no history of organizing on the basis of a peasant identity, as they did in Latin America, or any identity other than one which emphasizes, ... strategically today largely because international organizations such as the United Nations, the International Labour Organization, and UNESCO, as well as human rights groups, The Identity Approach 29 and ... example, an individual’s right to use a language is practically useless unless others (and usually many others) share the language and can practice it together Similarly, some crucial religious practices...

Ngày tải lên: 10/06/2014, 21:25

197 386 0
 canoe country wildlife a field guide to the north woods and boundary waters jul 1992

canoe country wildlife a field guide to the north woods and boundary waters jul 1992

... Lake Saganaga, Knife Lake, Basswood, and Lac la Croix form the 100-mile international border between the Boundary Waters and Quetico—between the United States and Canada The Boundary Waters and ... back that this strange animal swam in the water all day and had scales on \te> tail So by papal decree the Beaver wae> officially declared a fish, and the voyageurs could eat It any day of the ... spread to create 7-inch-wide paddles Beavers have a special air passage separate from the larynx and can tolerate high levels of carbon dioxide in their blood These adaptations allow the Beaver to...

Ngày tải lên: 11/06/2014, 17:08

240 537 0
– ANSWERS – Set 7 (Page 13) 102. c. A leopard, cougar, and lion all belong to the cat family; doc

– ANSWERS – Set 7 (Page 13) 102. c. A leopard, cougar, and lion all belong to the cat family; doc

... more than doze, and hibernate is more than sleep The other choices are not related in the same way 246 a A banquet and a feast are both large meals; a palace and a mansion are both large places ... is to photograph as teakettle is to a cup of tea The camera is used to make the photo; the teakettle is used to make the tea 214.b Hat and mittens are to desert as snorkel and flippers are to ... Not all hurricanes cause damage (choice c) 170 c Without a signature, there is no autograph Athletes and actors (choices a and b) may sign autographs, but they are not essential An autograph can...

Ngày tải lên: 18/06/2014, 17:20

23 431 0
Health and Quality of Life Outcomes BioMed Central Commentary Open Access A brief guide to the pdf

Health and Quality of Life Outcomes BioMed Central Commentary Open Access A brief guide to the pdf

... psychometric data, of varying kinds Factor analysis or item analysis is used to demonstrate the unidimensionality of a scale or subscale (i.e., that the items of the scale can be meaningfully added to form ... present data demonstrating that their scale is sensitive to change in these circumstances, and the same data can be used for another purpose, to demonstrate effect size of a treatment A longitudinally ... of a scale Neither the scale nor the treatment can be characterised as showing a particular effect size (i.e., having a particular sensitivity to change), because each depends on other factors...

Ngày tải lên: 20/06/2014, 15:20

5 349 0
Báo cáo khoa học: "Genetic determination of vessel area in oak (Quercus robur L and Q petraea Liebl): a characteristic related to the occurrence of stem shakes" docx

Báo cáo khoa học: "Genetic determination of vessel area in oak (Quercus robur L and Q petraea Liebl): a characteristic related to the occurrence of stem shakes" docx

... areas in ash (Doley and Leyton, 1968) The fact that IAA is also known to inhibit the emergence of buds in Q alba (Vogt and Cox, 1970) strongly suggests that leaf emergence and earlywood formation ... highly significant differences between early and late flushing trees (P > 0.0001) which accounted for almost 20% of all variation Means and standard errors for vessel areas for early and late flushing ... family i, on data may individual μ is the overall vessel area; g is the effect of genoi as random; ij e is the normally and independently distributed random deviation of genotype i, with a...

Ngày tải lên: 08/08/2014, 19:21

4 287 0
Báo cáo y học: "Adrenal suppression: A practical guide to the screening and management of this under-recognized complication of inhaled corticosteroid therapy" pptx

Báo cáo y học: "Adrenal suppression: A practical guide to the screening and management of this under-recognized complication of inhaled corticosteroid therapy" pptx

... desirable Several Table Pharmacodynamic (PD) and pharmacokinetic (PK) properties of the ICSs available for the management of asthma in Canada[53,54] ICS Beclomethasone dipropionate Oral bioavailability ... that effective antiinflammatory therapy is essential for the treatment of asthma, that ICSs are the most effective anti-inflammatory agents available, and that the suppressive effects of ICS therapy ... Ontario, Canada 4University of Calgary, Alberta Children’s Hospital, Calgary, Alberta, Canada Authors’ contributions AA contributed to the conception, drafting and writing of the manuscript and...

Ngày tải lên: 08/08/2014, 21:20

12 774 0
Báo cáo y học: "Cholestatic jaundice, acute kidney injury and acute pancreatitis secondary to the recreational use of methandrostenolone: a case report" potx

Báo cáo y học: "Cholestatic jaundice, acute kidney injury and acute pancreatitis secondary to the recreational use of methandrostenolone: a case report" potx

... 1M9, Canada Authors’ contributions GR and AC were major contributors in writing the manuscript EY and PK analyzed and interpreted the patient data regarding the patient’s presentation and provided ... AAS use as the main culprit in both his acute kidney injury and pancreatitis Conclusion AAS use and misuse is being seen in an expanding population of patients because they are readily available ... “remain in shape” as the main reason for taking these pills Anabolic steroids are readily available to the general public over the internet and at public gyms, they are easily obtained illegally, without...

Ngày tải lên: 11/08/2014, 00:23

5 274 0
Tailoring an intervention to the context and system redesign related to the intervention: A case study of implementing shared medical appointments for diabetes ppt

Tailoring an intervention to the context and system redesign related to the intervention: A case study of implementing shared medical appointments for diabetes ppt

... specific barriers, especially factors other than those related to the individual professional (e.g., factors related to the patient, the healthcare team, the healthcare organization and the healthcare ... Organizational direction at the level of the macro- and supramacro-systems had a greater influence; there were mandates to conduct SMAs issued by the VHA, primarily to address issues related to waiting ... factors associated with the general mandate to conduct SMAs and the specific decision to translate the mandated innovation into the local context: limited resources (such as space); potential to alter...

Ngày tải lên: 11/08/2014, 05:21

15 397 0
w