... carried out in polyethylene bags in a water bath The time at treatment temperature was 60 with the exception of a 150 treatment time which was also tested for selected test points The water to straw ... was 120°C and time at treatment temperature 60 No chemicals were added After the hot water treatment, the straw was washed and then refined with the batch type VTT wing refiner at 120°C and 1500 ... straw pulp in the mix Another interesting option is to increase the hot water treatment temperature (Paper V) The preliminary results showed that if the hot water treatment and the following...
Ngày tải lên: 22/02/2014, 09:20
... investigated Adsorption equilibrium and adsorption kinetics were also studied through batch experiment MATERIALS AND METHODS Synthetic groundwater Typical groundwater with average concentration ... water tank Pump Flow meter LA portion AC-Fe portion Treated water tank ICP-MS Computer Figure Experimental set-up RESULTS AND DISCUSSION Adsorption isotherm Assuming that the adsorption/desorption ... realize that the longer the portion of AC-Fe, the higher the adsorbent cost Therefore, optimizing the AC-Fe portion in the column is one of the key factors for a feasible arsenic treatment system To...
Ngày tải lên: 05/09/2013, 09:38
Tài liệu Báo cáo Y học: Electrochemical, FT-IR and UV/VIS spectroscopic properties of the caa3 oxidase from T. thermophilus docx
... protein We note that these assignments are tentative and can be supported by the combination with site-directed mutagenesis or labeling experiments Interestingly potential titrations of the enzyme ... concomitant with the reduced state at 1515 cm)1 and the mode typical for the deprotonated form at 1498 cm)1, indicating the protonation of a tyrosine residue with the reduction of the protein Also the ... respectively) The potential at )220 mV can be attributed to the heme a3–CN– signal, this shift reflecting the characteristic behavior of cytochrome c oxidases heme a is expected to contribute with two steps,...
Ngày tải lên: 21/02/2014, 15:20
Báo cáo khoa học: Improving thermostability and catalytic activity of pyranose 2-oxidase from Trametes multicolor by rational and semi-rational design pdf
... Strengthening this interaction by the introduction of a better-suited residue might therefore improve subunit subunit interactions and hence stability Saturation mutagenesis at this position and ... state of the species possessing the residual CD spectrum and activity associated with the rst DSC transition Structure of the P2Ox variants Data collection and model statistics are given in Table ... electron density and points into the internal cavity at the centre of the homotetramer In the L537G mutant structure, the elimination of the relatively large and hydrophobic Leu side chain results...
Ngày tải lên: 07/03/2014, 03:20
Báo cáo khoa học: Characterization of the tRNA and ribosome-dependent pppGpp-synthesis by recombinant stringent factor from Escherichia coli pot
... concluded from this experiment that maximal SF-activation required that the A-site was saturated with unacylated tRNA Is the tRNA-stimulatory effect affected by the order of addition of tRNA and SF to ... but it is not understood how the tRNA is directed to the A-site in the cell The data presented here does not support the hypothesis that SF directs unacylated tRNA to the ribosomal A-site for the ... Wendrich et al [7] tRNA and ribosome-dependent synthesis by stringent factor the tRNA saturation curves might be affected by the amount of SF present in the reaction Therefore, the tRNA-saturation...
Ngày tải lên: 07/03/2014, 16:20
Oncogene and Cancer – From Bench to Clinic Edited by Yahwardiah Siregar ppt
... Tumours that were COX-2 positive both at baseline and after treatment had the worst outcome, while those that were COX-2 negative both at baseline and after treatment had the best outcome with a ... ligandactivated state but permitting it to dimerize in the absence of a ligand (Figure 2) The constitutive open structure of HER2 helps to explain its readiness to interact with the ligandactivated ... opportunity to study tumour DNA, RNA and protein changes and to evaluate new prognostic and predictive biomarkers of treatment response In addition, it has the potential to reveal post-treatment...
Ngày tải lên: 16/03/2014, 21:20
Oncogene and Cancer – From Bench to Clinic Edited by Yahwardiah Siregar docx
... Tumours that were COX-2 positive both at baseline and after treatment had the worst outcome, while those that were COX-2 negative both at baseline and after treatment had the best outcome with a ... ligandactivated state but permitting it to dimerize in the absence of a ligand (Figure 2) The constitutive open structure of HER2 helps to explain its readiness to interact with the ligandactivated ... opportunity to study tumour DNA, RNA and protein changes and to evaluate new prognostic and predictive biomarkers of treatment response In addition, it has the potential to reveal post-treatment...
Ngày tải lên: 23/03/2014, 14:20
Báo cáo khoa học: The phosphate site of trehalose phosphorylase from Schizophyllum communeprobed by site-directed mutagenesis and chemical rescue studies pptx
... catalytic defect in R507A by guanidine displayed saturation behavior with respect to both the rescue agent and the substrate Therefore, this suggests that guanidine binds to the cleft vacated by ... reactant state, Arg507 promotes the catalytic step of glucosyl transfer through a selective stabilization of the transition state of the reaction Occupancy of the phosphate binding site in wild-type ... Equation (1) was tted to data from activity restoration experiments where kmax is the maximum initial rate, divided by [E], obtained at a saturating concentration of the rescue agent, and KR is the...
Ngày tải lên: 30/03/2014, 04:20
Báo cáo khoa học: b-Amyloid protein oligomers induced by metal ions and acid pH are distinct from those generated by slow spontaneous ageing at neutral pH docx
... was due to Ab aggregating to such an extent that it was unable to enter the gel Taken together, the results from both gel systems demonstrated that initially, most of the Ab1–40 was present in an ... calculated by the Student’s two-tailed t- test in the sensitivity of specific Ab oligomers to disassembly by SDS Interestingly, the results of the PAGE experiments suggested that some of the Ab ... observed by PAGE and that different patterns of Ab aggregation are observed, depending upon the method by which aggregation is measured Taken together these results suggest that Ab aggregates by two...
Ngày tải lên: 31/03/2014, 07:20
Oncogene and Cancer – From Bench to Clinic by Yahwardiah Siregar ppt
... Tumours that were COX-2 positive both at baseline and after treatment had the worst outcome, while those that were COX-2 negative both at baseline and after treatment had the best outcome with a ... ligandactivated state but permitting it to dimerize in the absence of a ligand (Figure 2) The constitutive open structure of HER2 helps to explain its readiness to interact with the ligandactivated ... opportunity to study tumour DNA, RNA and protein changes and to evaluate new prognostic and predictive biomarkers of treatment response In addition, it has the potential to reveal post-treatment...
Ngày tải lên: 31/03/2014, 19:20
báo cáo hóa học:" In vitro generation of cytotoxic and regulatory T cells by fusions of human dendritic cells and hepatocellular carcinoma cells" docx
... [25] Therefore, we investigated whether supernatants derived from the HCC cells affect the function and maturation of DCs The data show that exposure of immature DCs to the supernatants results ... against the HCC cells (Figure 3E), suggesting that the soluble factors in the supernatant inhibit the maturation of fusion cells and have a negative impact in the stimulation of T cells To determine ... 7A) These results suggest that vaccination with autologous FCs has the potential to increase CTL precursors against autologous HCC cells in the patient To assess the antigen specificity and HLA...
Ngày tải lên: 18/06/2014, 15:20
báo cáo hóa học:" Comparative study on the immunogenicity between an HLA-A24-restricted cytotoxic T-cell epitope derived from survivin and that from its splice variant survivin-2B in oral cancer patients" pot
... induction, killing assays and drafted the manuscript TT and YH participated in the design of the study and performed the evaluation of the data TT helped to draft the manuscript SI contributed to ... breast cancer patient by stimulating with survivin-C58 peptidepulsed APCs After four times stimulation, CTLs were subjected to standard 51Cr release assay at the indicated effector/target (E /T) ... over the period of http://www.translational-medicine.com/content/7/1/1 two weeks One week after the 4th stimulation, cytotoxic activity of the CTLs was measured by 51Cr release assay Cytotoxicity...
Ngày tải lên: 18/06/2014, 15:20
Climate Policy Foundations: Science and Economics with Lessons from Monetary Regulation – By William C. Whitesell potx
Ngày tải lên: 20/06/2014, 18:20
DON’T SIGNTHIS LEASESECRETS: TO CASH FREE RENTS AND BONUSES FROM LANDLORDS IN THIS REAL ESTATE pot
... between two parties: the landlord and the tenant This contract can be verbal or written A verbal contract is usually left to the good faith of each party as to the interpretation of what both ... lease, to double-charge the basic rent to this tenant for the next twelve months Due to the short notice, the landlord had too much power So I agreed to represent this tenant on the condition that ... improved my strategy for the last thirty-three years, and it has proven to protect the interests of my clients, commercial tenants These strategies will teach you how to checkmate landlords and leasing...
Ngày tải lên: 27/06/2014, 23:20
EU Research on Environment and Health - Results from projects funded by the Fifth Framework Programme docx
... Despite the fact that these patients take high doses of standard asthma medications they are difficult to control and very handicapped by their disease Objectives The aim of the project was to uncover ... that now will be analysed in goals of developing better methods for diagnosis, great detail in the next few years It is hoped that prevention and treatment It thereby contributes to this platform ... to be harmful to humans, wildlife and/ or the environment, but for others toxicity and ecotoxicity data are not readily available FP5 projects – Towards a better understanding Understanding the...
Ngày tải lên: 28/06/2014, 12:20
The Minds and Manners of Wild Animals by William T. Hornaday docx
... interpretations is a trap ever ready for the feet of the unwary It is better to see nothing than to see a lot of things that are not true In the study of animals, we have long insisted that to the ... THE TRUE MENTAL STATUS OF THE GORILLA XI THE MIND OF THE ELEPHANT XII THE MENTAL AND MORAL TRAITS OF BEARS XIII MENTAL TRAITS OF A FEW RUMINANTS XIV MENTAL TRAITS OF A FEW RODENTS XV THE MENTAL ... but rather to see what the animal subject thinks and does by its own initiative In the testing of memory and the perceptive faculties, training for performances is the best method to pursue The...
Ngày tải lên: 28/06/2014, 19:20
Báo cáo y học: "Expression of the inflammatory chemokines CCL5, CCL3 and CXCL10 in juvenile idiopathic arthritis, and demonstration of CCL5 production by an atypical subset of CD8+ T cells" pps
... blood T cells of this subpopulation Overall, this study contributes to our understanding of recruitment of T cells to the joint in inflammatory arthritis and suggests that in the microenvironment ... blood and synovial T cells, we further investigated the population producing CCL5 from the joints of patients with JIA by flow cytometric analysis CCL5 protein was detected within T lymphocytes from ... detected (data not shown) This correlates with recent reports that CCL5 secretion from memory and effector CD8+ T cells is from stored granules, thought to be distinct from lysosomal secretory granules,...
Ngày tải lên: 09/08/2014, 07:20
báo cáo khoa học: "Reactivating aberrantly hypermethylated p15 gene in leukemic T cells by a phenylhexyl isothiocyanate mediated inter-active mechanism on DNA and chromatin" potx
... actin2 F:ctacaatgagctgcgtgtggc R:caggtccagacgcaggatggc p15 DNMT1 R:ggtttgacttcggagtctct DNMT3A F:cacacagaagcatatccaggagtg R:agtggactgggaaaccaaataccc DNMT3B F:aatgtgaatccagccaggaaaggc R:actggattacactccaggaaccgt ... bp) were tgtgatgtgtttgtattttgtggtt (positive sense) and ccatacaataaccaaacaaccaa (antisense) The amplification was performed in an Mastercycler unit (Eppendorf) under the program conditions as ... and the unmethylated (U) CpG sites The primers for the methylated form of p15 (148pb) were gcgttcgtattttgcggtt (positive sense), and cgtacaataaccgaacgaccga (antisense) The primers for unmethylated...
Ngày tải lên: 10/08/2014, 22:21
Báo cáo y học: "Tetra-O-methyl nordihydroguaiaretic acid (Terameprocol) inhibits the NF-B-dependent transcription of TNF-a and MCP-1/CCL2 genes by preventing RelA from binding its cognate sites on DNA" ppsx
... hypothesized, that the inhibitory effects of TMP on the transcription of TNF-a and MCP-1/CCL2 mRNAs might stem from the effect of the drug on the activity of NF-B proteins To test this hypothesis, ... activity approximately fold This effect was inhibited by TMP by approximately 60%, a result consistent with the hypothesis that TMP inhibits the activity of NF-B This effect was dose dependent ... experiment was performed at least times and representative experiments are shown Asterisks indicate significant differences between ligand treatments and ligand treatments with TMP (p < 0.05, T- test)...
Ngày tải lên: 11/08/2014, 03:20