... modeling Therefore, EPA convened a workshop in Atlanta, Georgia, on anaerobic biodegradation of organic chemicals in 1997 Representatives from academia, industry and the EPA participated in discussions ... limited by mass transfer processes from ground water that has not been impacted (and as a consequence has oxygen and nitrate available) into the plume impacted with leachate from a landfill As a result, ... criteria indicated as unacceptable in Appendix A or B Appendices D, E, F, and G summarize the review of available biodegradation studies satisfying the proposed EPA criteria (Appendices A & B)...
Ngày tải lên: 28/03/2014, 19:20
... biodegradation rate constant database previously compiled (Aronson and Howard, 1997), the aerobic biodegradation rate constant database includes rate constant information from soil, surface water, and ... evidence of biodegradation at a specific location and can provide an “absolute mass balance” on a particular contaminant In addition, the formation and measurement of metabolites can definitively show ... in the following sections Separation of the data into mineralization and primary degradation studies was initially completed and each category was considered separately A range was given to represent...
Ngày tải lên: 28/03/2014, 19:20
CAREERS IN FINANCIAL MARKETS - YOUR GUIDE TO FINDING A JOB IN SECURITIES AND BANKING 2010-11: Navigating the New Landscape docx
... American, Hispanic/Latino, Native American Financial Women’s Association (FWA) www.fwa.org Women National Black MBA Association (NBMBAA) www.nbmbaa.org African American Graduate Management Admission ... offers information about litigation and administrative proceedings against firms and individuals, as well as EDGAR (Electronic Data Gathering, Analysis, and Retrieval), a database of public company ... Performance and Achievement) www.hispa.org Hispanic/Latino American Indian Graduate Center (AIGC) www.aigcs.org American Indian and Alaska Native Hispanic Alliance for Career Enhancement (HACE)...
Ngày tải lên: 29/03/2014, 18:20
an oh maser flare with a strong magnetic field in w75n
... maser features and the simultaneous dimming of nearby features can be interpreted as originating from the passage of a magnetohydrodynamic (MHD) shock (Alakoz et al 2005) The shock was probably ... have also been found near the OH masers in W75N, located in two clusters around VLA1 and VLA2 Torrelles et al (2003) have found a shell of water masers around the ultra-compact HII region VLA2 ... VLA2, at a distance of 55 mas (±40 mas), or at the projected distance of 110 AU (±80 AU) Therefore, the OH masers may well be located in the same shell as the water masers The magnetic field in...
Ngày tải lên: 28/04/2014, 13:15
increased real contact in thermal interfaces a carbon nanotube field material
... Obtained from data fit where the CNT arrays are not considered as a layer in the PA model ing procedure, so that further increases in pressure not cause a significant increase in array-to-array ... multilayer materials,23 the sample in a PA measurement can consist of any arbitrary number of layers, a backing material ͑0͒ and N successive layers ͑1 , , , N͒, and is heated by a modulated laser ... 10−4 a Obtained from data fit where the CNT arrays are not considered as a layer in the PA model ͑RCNT-Ag͒ dominates the overall thermal resistance A similar characteristic for one-sided CNT interfaces...
Ngày tải lên: 06/05/2014, 08:53
Báo cáo hóa học: " Gold colloidal nanoparticle electrodeposition on a silicon surface in a uniform electric field" pdf
... surfaces Uniform distribution was obtained and adsorption was irreversible The density of a gold nanoparticle assembly was investigated and analyzed in relation to several parameters such as voltage, ... As the differences in particle concentration in the liquid have already been taken into account in the percentage values, the variations in deposited nanoparticle density are not solely explained ... ImageJ software on contrastenhanced images For one sample, the silicon substrate was replaced by a platinum-coated silicon substrate The platinum material was deposited by sputtering (under a...
Ngày tải lên: 20/06/2014, 22:20
Báo cáo hóa học: " Research Article Electroelastic Wave Scattering in a Cracked Dielectric Polymer under a Uniform Electric Field" doc
... unknowns A1 a α , A2 a α are related to the new one Aa α through A1 a α − 2α2 − γ1 α p/c2 p c2 Aa α E0 2A1 μ ε0 η α2 aa α , 4.39 − A2 a α p/c2 E0 A2 αaa α 2αAa α − μ The unknowns Aa α and aa α can be ... solutions a , ϕea , ψea and a are a ϕea π ∞ − aa α e−αy sin αx dα, 4.30 c2 p A2 a α e−γ2 αy A1 a α e−γ1 αy ψea ∞ π π ∞ a − π E0 2A1 μ − c2 p A2 A3 αaa α e−αy E0 A2 αaa α e−αy μ sin αx dα, cos ... aa α cosh αy sin αx dα, 4.32 12 Boundary Value Problems where aa α , A1 a α , A2 a α , and aa α are unknown functions The displacements and stresses are obtained as uxa π ∞ A1 a α e−γ1 c2 p uya...
Ngày tải lên: 21/06/2014, 20:20
Báo cáo hóa học: " A Study on Field Emission Characteristics of Planar Graphene Layers Obtained from a Highly Oriented Pyrolyzed Graphite Block" potx
... f) In order to find and evaluate the graphene layers, the thickness of SiO2 layer on Si was set to 300 nm considering optical interference [8] A Zyvex Nanomanipulator operating inside a scanning ... changed and the linear region (red line) begins as shown in Fig 5b In order to estimate the field-enhancement factor, b, F–N parameters were evaluated by linear fit of the red line as shown in ... vacuum chamber, two tungsten tips were located on the graphene sample; one was contacted directly to the sample and grounded as a cathode, and the other was placed an arbitrary distance, d, apart...
Ngày tải lên: 22/06/2014, 00:20
Báo cáo lâm nghiệp: "and nutrient cycling of a highly productive Corsican pine stand on former heathland in northern Belgium" docx
... model Na is assumed not to be influenced by exchange and Ca-, Mg- and K-bearing particles are assumed to have the same mass median diameter as Na- containing particles [9] The particle interception ... generation pine stands established on former heathlands and sand dunes The forest is located at the edge of the High Campine plateau and ranges in elevation from 50 to 58 m The Campine plateau ... deposition has perhaps been off- by a shift towards the woody parts or a gradual increase in foliar biomass Aber et al [1] suggested that in the initial stages of the development of nitrogen saturation,...
Ngày tải lên: 09/08/2014, 04:20
Báo cáo khoa học: "Lack of Cetuximab induced skin toxicity in a previously irradiated field: case report and review of the literature" pdf
... erythema and dry skin remain in areas previously dominated by the papulopustular eruption [9] Here, we report a case of lack of Cetuximab-induced skin rash in an area that had previously been irradiated ... ear This was initially excised and treated with adjuvant radiation treatment using 12 MeV electrons between January and March 2008 An initial dose of 50 Gy was delivered to the external ear and ... with erlotinib, a small molecule inhibitor of tyrosine kinase Again, the interval between the previous radiation treatment and administration erlotinib varied, months after prior treatment with...
Ngày tải lên: 09/08/2014, 08:23
Báo cáo khoa học: "A biologically competitive 21 days hypofractionation scheme with weekly concomitant boost in breast cancer radiotherapy feasibility acute sub-acute and short term late effects" pot
... and treatment planning A planning CT scan was carried out for each patient with the patient positioned supine on a “wing-board” with both arms raised above the head Radiopaque wires and markers ... be part of the cavity The boost CTV was generated by adding at least a mm margin around the lumpectomy cavity and the corresponding PTV created by adding a further mm D margin The heart and ipsilateral ... boost; C: plan sum Page of Table RTOG Acute Skin Score Grade No change over baseline Grade Grade Grade Grade Follicular, faint or dull erythema/epilation/dry desquamation/ decreased sweating Tender...
Ngày tải lên: 09/08/2014, 09:20
báo cáo khoa học: "Selection for abdominal bristle number in Drosophila subobscura, a highly polymorphic species" ppsx
... important are REVOSTI P (1967), while artificially selecting for an adaptative trait, wing length, in Drosophila subobscura, found a stronger response than that obtained in Drosophila melanogaster ... females of a wild population of D subobscura, from Ribarroja (Valencia, Spain), was used to start the population used in this experiment The population was maintained in the laboratory for months ... in a neutral trait For this reason, an artificial selection experiment for abdominal bristle number in D subobscura was initiated Abdominal bristle number is classically considered to be a neutral...
Ngày tải lên: 09/08/2014, 22:22
báo cáo khoa học: " A highly conserved NB-LRR encoding gene cluster effective against Setosphaeria turcica in sorghum" potx
... fungal DNA was extracted using a modified CTAB method [42] DNA was analyzed by using S turcica specific ITS1 and ITS2 primers (F – GCAACAGTGCTCTGCTGAAA and R-ATAAGACGGCCAACACCAAG) PCR was carried ... cDNA-AFLP analysis Water treated control samples were harvested at the same time-points 14 RNA extraction and cDNA-AFLP analysis Total RNA was isolated from the leaf samples using the BioRad RNA ... modified via various genic and intergenic processes enabling rapid evolution and adaptation to changes in a pathogen genome [10] R-genes can also act in pairs [11,12] The R-gene pairs can differ in genomic...
Ngày tải lên: 11/08/2014, 11:21
báo cáo khoa học:" Histological analysis of the effects of a static magnetic field on bone healing process in rat femurs" pptx
... direction maintained continuity and shape of the remaining cortical levels Trabecular proliferation was also apparent in a centripetal direction relative to the surgical cavity Medullary spaces showed ... Janeiro: Guanabara Koogan; 1994 Feinberg SE, Steinberg B, Helman JI: Healing of Traumatic Injuries In Oral and Maxillofacial Trauma Volume Edited by: Fonseca RJ, Walker RV Philadelphia: Saunders; ... channel Discussion As in many other studies reported, rat was also used as a model in this study [1,6,8-10] The advantages include easy manipulation, maintenance and adaptation to the objectives...
Ngày tải lên: 11/08/2014, 23:22
Báo cáo y học: "Use of a highly sensitive strand-specific quantitative PCR to identify abortive replication in the mouse model of respiratory syncytial virus disease" pptx
... vitro standard external positive sense TCCAGCAAATACACCATCCA In vitro standard external negative sense CTGCTTCACCACCCAATTTT In vitro standard nested positive sense ATAGAATTCGGTATGTTATATGCGATGTCTAGGT1 ... ATAGAATTCGGTATGTTATATGCGATGTCTAGGT1 In vitro standard nested positive sense ATAGGATCCTGCTAAGACTCCCCACCGTAA2 Positive sense RNA-specific cDNA synthesis CGGTCATGGTGGCGAATAATCCTGCAAAAATCCCTTCAACT3 Negative sense RNA-specific cDNA ... synthesis CGGTCATGGTGGCGAATAAACTTTATAGATGTTTTTGTTCA3 Positive sense-specific QPCR primer CGGTCATGGTGGCGAATAA Probe TCCTGCAAAAATCCCTTCAACT QPCR tag primer CCCCACTTTATAGATGTTTTTGTTCA Negative sense-specific...
Ngày tải lên: 12/08/2014, 01:22
Báo cáo y học: " A highly attenuated recombinant human respiratory syncytial virus lacking the G protein induces long-lasting protection in cotton rats" pot
... inoculation with live attenuated vaccine candidates [7] These are important facts in favor of a live attenuated RSV vaccine administered intranasally The most challenging aspect of developing a live ... response in human volunteers after intranasal administration, and was considered to be over-attenuated as a vaccine candidate In the bovine model, however, a recombinant bovine RSV deletion mutant ... [21,22] A recombinant bRSV lacking the G gene induced bRSV neutralizing antibodies after intranasal immunization of calves Although it was not clear whether this mutant was able to replicate in the...
Ngày tải lên: 12/08/2014, 04:20
towards sustainability of land use in a highly vulnerable and degraded
... clay shale, marl Bearing Eumorphotis reticulata, E inaequicostata, Claraia aurita, C stachei Thickness 310m 12 T1 Viên Nam Formation: aphyric basalt, magnesium-high basalt, andesitobasalt, andesitodacite, ... which allows representing, manipulating, storing, and analyzing features on the Earth’s surface, that are geographically and spatially referenced Since originated, it has been defined in many different ... spatially distributed features, activities, or events, which are definable in space as points, lines, or areas A GIS manipulates data about these points, lines, and areas to retrieve data for ad...
Ngày tải lên: 11/09/2015, 15:45
OBSTRUCTIVE SLEEP APNEA DIAGNOSIS WITH APNEA EVENT DETECTION IN SNORING SOUND USING a CONDITIONAL RANDOM FIELD
... that validates the performance on apnea event detection Moreover, we have shown that automatic annotation of apnea events using CRF has the potential to replace manual annotation and reduce labor ... Observation Extraction for CRF Training and Testing To diagnose OSA, we propose a relational learning method using CRF to detect respiratory events As CRF requires discrete training data, we extract ... features are extracted from snore episodes These features, containing the abnormality of OSA, are fed into classification models to diagnose OSA Therefore, three main aspects are investigated in...
Ngày tải lên: 27/11/2015, 11:25
Đơn Xin Việc Bằng Tiếng Anh Applying For A Job In English
... a) s.it fgo\ E :o.rJd) :F fq f.lN-OLats > o sE + A- t1r 'A iliTA L oo i-> Er o o! quo >\-O I x o I () \C cD O\ cO ro 6@ \o O 00 O O, b E x EO a o (t l! a € iultrl o 0, a q, E a, A xtltt tI] a ... u v.5 !E* ?s,, a tr i; u d goo qa ti r'E€g aoP'E.F: rsS ' *cE >EE El *xs €',aX - - € :d E ! E" El i ,a: : = E'Ea €p *;.8'?=saaf;= $E S E qJ i$ ts ts S S J \S (\l :*; ; Esi E E ; ^A, i € * E E > tr ... *4 gE a ot ,g s) \J a) o uo JF :; €s' € < c3 -a o 55 cJ 9iP o :E s a Et = E; o i!E= > \ :!lo);s \ (' o'= - \) (rj L a { oC o o o : t @ =o E l9 u E E6\ N F Ad, - a !:; s e? €oa+ €EJ$ FE 5E ar) e...
Ngày tải lên: 16/03/2016, 17:24
Bạn có muốn tìm thêm với từ khóa: