... 5¢-d(TCAGAAATTAAAGCGG ATGCATTATTTGCATG)-3¢ The upstream primer containing the NdeI restriction site (underlined) was: 5¢-d(GCTAGCATATGAAGCTTAAA AAAATTG)-3¢ and the downstream primer containing the ... clashes with the aromatic ring of Tyr269, and these unfavorable interactions could lead to a decrease of local flexibility and an increased Ea value The validity of the above interpretation was ... value almost 2.5-fold higher than the native cold adapted enzyme (Table 1) The mutant G26 1A/ Y26 9A exhibits an Ea almost the same as in the case of the native enzyme (Table 1) Thermal inactivation...
Ngày tải lên: 22/02/2014, 04:20
... obtained by P1 transduction using strain CE1224 as the recipient and strains IQ85 and strain MM152, respectively, as donor strains To obtain strain CE1513, strain MM88 was used as Table Bacterial ... [13] Quantification of the data indicated that the cross-linking efficiency of the mutant nascent chains was somewhat reduced (Fig 3B) In conclusion, our results show an increased affinity of the G-10C ... molecules may still rely on the SecB pathway, because of overloading of the SRP pathway The re-routing of (G-10L)prePhoE to the Sec translocon via the SRP instead of the SecB pathway could be explained...
Ngày tải lên: 08/03/2014, 09:20
Báo cáo "The linguitic Situation of a Hmong Community in the North - West of Vietnam " pdf
Ngày tải lên: 12/03/2014, 00:21
The Project Gutenberg EBook of A First Book in Algebra, pot
... − 7a − 3a From take 2a 5a − 3a To add 2a − 5a − 3a From take − 4a To − 4a − 3a add 3a a a The principle is clear; namely, The subtraction of any number gives the same result as the addition of that number ... remain in the tank at the end of five days? 18 Two men are 150 miles apart, and approach each other, one at the rate of x miles an hour, the other at the rate of y miles an hour How far apart ... − 4a, − 3a, − 2a, a, −0, a, 2a, 3a, 4a, 5a What must be added to 2a to obtain 5a? What then must be subtracted from 5a to obtain 2a? 5a − 3a =? What must be added to − 3a to obtain 4a? What then must...
Ngày tải lên: 15/03/2014, 00:20
Báo cáo khoa học: The antagonistic effect of hydroxyl radical on the development of a hypersensitive response in tobacco pot
... level after ParA1 treatment H2O, H2O pretreatment; H + ParA1, ParA1 in ltration after H2O treatment; A4 00, 400 lM ABA pretreatment; A + ParA1, ParA1 in ltration after ABA treatment All the spectra ... of the HR in the PR zone was significantly suppressed as compared with that in the ParA1 zone In the ParA1 zone, the ion leakage increased dramatically within 12–24 h, whereas in the PR zone the ... with the following oligonucleotide primers: 5¢-TGAATTCAATAATGTCTAACTTCCGCGCTCTGTTC-3¢ and 5¢-AGGTACCTCAATGATGATGATGAT GATGATGCAGTGACGCGCACGTAGA-3¢ For the successful protein expression, a yeast...
Ngày tải lên: 15/03/2014, 00:20
Báo cáo khoa học: Predicting the substrate specificity of a glycosyltransferase implicated in the production of phenolic volatiles in tomato fruit pptx
... SG a Os an ali th A 4B T7 UG 4F2 A na ia al th a an A na a ia alia na al an th ali A th A 4C 1A 4D T7 4E T7 th na alia A th ana hali B1 ana ali A th 1A 1A T9 UG hali A t 1B C1 T9 T91 UG UG A ... vinifera ax T84 A thaliana UGT76F1 UG a lian tha ali ari icum th a 2F rag a 1A lian GT na copers Fa 6A tha ia an T8 H S ly S3950 A al th ali 1A 76E UGT D1 th na alia lor ico a b an TS ali th A A ... B1 A th aliana CaU GT1 C ro seu UG s T7 1C UG 1A T7 th UG alia 1D T8 na UG A 8A T7 th 2E ali A 2A an th a th al ia ali na an a thalia 1A th alia na na 6B1 A UG T76 C UGT7 A1 CAO69089 V vinifera...
Ngày tải lên: 28/03/2014, 23:20
Báo cáo khoa học: Determination of the metal ion dependence and substrate specificity of a hydratase involved in the degradation pathway of biphenyl/chlorobiphenyl pot
... substrate Therefore, the metal ion has a catalytic rather than just a substrate binding role Possible roles of the cation include the activation of water for the hydration reaction and ⁄ or the stabilization ... pathway [5] The binding of divalent cations by the decarboxylase precludes metal binding studies of the hydratase in that complex In this study, BphH, the hydratase in the PCBs degradation pathway ... Ontario, Canada) or New England Biolabs (Pickering, Ontario, Canada) All other chemicals were of analytical grade and were obtained from Sigma-Aldrich and Fisher Scientific (Nepean, Ontario, Canada)...
Ngày tải lên: 30/03/2014, 15:20
Báo cáo sinh học: " Identification of a truncated nucleoprotein in avian metapneumovirus-infected cells encoded by a second AUG, in-frame to the full-length gene" potx
... GGGACAAGTG AAAATGTCTC TTCAGGGGAT TCAGCTTAGT GACTTGTCCT ATAAGCATGC AATCCTTAAA GAATCACAGT ACACAATCAA GGGACAAGTC AAAATGTCTC TTGAAAGTAT TAGACTCAGT GACTTGGAGT ACAAACATGC AATTCTTGAA GACTCTCAGT ATACAATTAG ... CTGAAGTAGG AATGCAGTAC GTGAGCACCA CACCGACTAT GAGCCTGCAG CAGAGGTAGG CATGCAGTAC ATTAGTACTG CACTGGGAGC AGAGCGTACA CAGCAGATAC TAAAGAACTC CTCTAGGAGC TGATAGAACT CAACAAATAC TGAAAAATTC 270 270 aMPV/C/US/Co aMPV /A/ UK/3b ... GCAATAAGAT AAATTTCTCA TGCACGGACA TTGAGAGAGA ACAACAAGAT CAACCTAGCG _ CATAA-ATGA -GGAAGGCCA GAATGATTAT GAGTAATTAA GGGGAGATGA TGAGAGATCA TCCAAATT-T GAGTAATTAA 1164 1154 aMPV/C/US/Co aMPV /A/ UK/3b...
Ngày tải lên: 19/06/2014, 08:20
báo cáo hóa học:" Identification of a truncated nucleoprotein in avian metapneumovirus-infected cells encoded by a second AUG, in-frame to the full-length gene" potx
... GGGACAAGTG AAAATGTCTC TTCAGGGGAT TCAGCTTAGT GACTTGTCCT ATAAGCATGC AATCCTTAAA GAATCACAGT ACACAATCAA GGGACAAGTC AAAATGTCTC TTGAAAGTAT TAGACTCAGT GACTTGGAGT ACAAACATGC AATTCTTGAA GACTCTCAGT ATACAATTAG ... CTGAAGTAGG AATGCAGTAC GTGAGCACCA CACCGACTAT GAGCCTGCAG CAGAGGTAGG CATGCAGTAC ATTAGTACTG CACTGGGAGC AGAGCGTACA CAGCAGATAC TAAAGAACTC CTCTAGGAGC TGATAGAACT CAACAAATAC TGAAAAATTC 270 270 aMPV/C/US/Co aMPV /A/ UK/3b ... GCAATAAGAT AAATTTCTCA TGCACGGACA TTGAGAGAGA ACAACAAGAT CAACCTAGCG _ CATAA-ATGA -GGAAGGCCA GAATGATTAT GAGTAATTAA GGGGAGATGA TGAGAGATCA TCCAAATT-T GAGTAATTAA 1164 1154 aMPV/C/US/Co aMPV /A/ UK/3b...
Ngày tải lên: 20/06/2014, 04:20
Báo cáo hóa học: " A fixed point approach to the Hyers-Ulam stability of a functional equation in various normed spaces" pptx
... Del Circolo Math Di Palermo (to appear) Kenary, HA, Shafaat, Kh, Shafei, M, Takbiri, G: Hyers-Ulam-Rassias stability of the Appollonius quadratic mapping in RNspaces J Nonlinear Sci Appl 4, 110–119 ... using the fixed point alternative approach, we prove the Hyers-Ulam stability of the functional equation (1) in fuzzy normed spaces In the rest of the article, assume that X is a vector space and ... equation J Inequal Appl 2011 (2011) Article ID 194394 13 Kenary, HA: On the Hyers-Ulam-Rassias stability of a functional equation in non-Archimedean and random normed spaces Acta Universitatis Apulensis...
Ngày tải lên: 20/06/2014, 22:20
báo cáo hóa học:" Research Article Iterative Methods for Variational Inequalities over the Intersection of the Fixed Points Set of a Nonexpansive Semigroup in Banach Spaces" pot
... the variational inequality problem of the intersection of fixed point sets of nonexpansive mappings,” in Inherently Parallel Algorithm for Feasibility and Optimization, D Butnariu, Y Censor, and ... Takahashi, Nonlinear Functional Analysis: Fixed Point Theory and Its Applications, Yokohama Publishers, Yokohama, Japan, 2002 13 P.-E Maing´ , “Approximation methods for common fixed points of ... NY, USA, 2001 F Deutsch and I Yamada, “Minimizing certain convex functions over the intersection of the fixed point sets of nonexpansive mappings,” Numerical Functional Analysis and Optimization,...
Ngày tải lên: 21/06/2014, 11:20
Báo cáo lâm nghiệp: "Processes of loss, recruitment, and increment in stands of a primeval character in selected areas of the Pieniny National Park (southern Poland" ppt
... Other Abies alba Fagus sylvatica 57 45 Fagus sylvatica and other broadleaves Abies alba 456 12 102 93 147 410 Abies alba Fagus sylvatica and other broadleaves Abies alba Fagus sylvatica and other ... other broadleaves Acer pseudoplatanus 75 85 Acer pseudoplatanus 60 Fagus sylvatica and other broadleaves Abies alba 10 Acer pseudoplatanus 80 63 Abies alba Living trees (trees/ha) Abies alba Fagus ... forests of the Bieszczady Mountains In the first place trees of the upper and middle layers of the investigated stands were dying Among them there were also trees of a normal vitality and average and...
Ngày tải lên: 07/08/2014, 03:22
Báo cáo lâm nghiệp: "Results of a phenological study of the tree layer of a mixed stand in the region of the Drahanská vrchovina Upland" ppt
... times a week In the summer and autumn season, the observations are carried out once a week The ordinal number of a day from the beginning of the calendar year was assigned to the date of particular ... herbs can also occur Phenological data are a certain expression of the climate character of a given region Thus, they can contribute to assess the variability of weather and also to evaluate the ... leaf area is terminated by the autumn phenological stage (autumn yellowing of leaves) According to budbreak 10% beginning of foliage formation 10% beginning of foliage formation 50% beginning of...
Ngày tải lên: 07/08/2014, 03:22
Báo cáo toán học: "The maximum size of a partial spread in H(4n + 1, q 2) is q 2n+1 + 1" docx
... obtain the desired inequality for every negative eigenvalue As the cliques of the oppositeness graph on generators of a polar space are precisely the partial spreads, we can now prove the main ... and ci are known as the intersection numbers of the distance-regular graph Γ If θ is any eigenvalue of a distance-regular graph Γ, then there is a series of eigenvalues {vi } of the associated ... particular, the valency of i the oppositeness graph Γd+1 is q (d+1)(d+2+2ǫ)/2 Calculation of a specific subset of eigenvalues of the association scheme The eigenvalues of the dual polar graph were already...
Ngày tải lên: 07/08/2014, 21:21
Báo cáo lâm nghiệp: "Spatio-temporal pattern of bog pine (Pinus uncinata var. rotundata) at the interface with the Norway spruce (Picea abies) belt on the edge of a raised bog in the Jura Mountains, Switzerland" doc
... class reduction (AGC single value) Abrupt growth change mean curve (AGCm curve) was based on annual values and was the mean of all AGC single values of all bog pines of the transect, using the ... (LV3) The basal area of Norway spruce increased from the wettest subplot towards the drier ones at the edge of the bog For the living bog pines, the maximum basal area was found in the middle of the ... used as descriptors for calculating the Euclidean distance matrix comparing all the individual trees Prior to the analysis, the data were standardised (zero mean and unit variance) Based on the...
Ngày tải lên: 08/08/2014, 01:21
Báo cáo khoa hoc:" Prediction of the response to a selection for canalisation of a continuous trait in animal breeding" pps
... performances of all the ,i d Y of a animals is where us and vs are parts of equation (42), and Cs are submatrices of equation (44) Note that all the individuals in the analysis are involved in these ... and Bayesian approaches to the analysis of heterogeneous residual variances in mixed linear Gaussian models, Comput Stat Data Anal 13 (1992) 291-305 [14] Gavrilets S., Hastings A. , A quantitative ... and their expressions as ratios of a covariance to a variance indicate that they can also be obtained from a linear approximation This comment makes it possible to extend easily the approximate...
Ngày tải lên: 09/08/2014, 18:21
Báo cáo khoa hoc:"Association of a missense mutation in the bovine leptin gene with carcass fat content and leptin mRNA levels" pps
... T A A - A T T A G C T G A C A A A A C C T A A A G T C C A G C C C A A A A C A A T A A A C T A A T C C C C T C C A C C C C A T T A C C C C A A A A C T T C A C C A A A A G G A A C C A A A A T T ... discovery of a SNP that adds an extra cysteine into the amino acid sequence of leptin, combined with a signicant association to carcass fat measurements and signicant variation in the level of mRNA detected ... hypothesized that the amino acid change from arginine to cysteine is imparting a functional difference to the leptin molecule One explanation may be that the cysteines presence in the A- helix of...
Ngày tải lên: 09/08/2014, 18:21
báo cáo khoa học: "Segregational patterns of a chromosome insertion in the progeny of twin chimeric bulls" potx
... as against cells with a normal karyotype (M et al., 1980) ORAES Because of the chimeric nature of the twins and the rarity of the insertion in the population, it was concluded that, in terms of ... vascular anastomosis taking place after the migration of the primordial germ cells to the site of the primitive gonad had finished, a mechanism which has been previously suggested to explain the ... 100 fetal calf serum, p 100 phytohemaglutinin M (Difco), 100 LU of penicillin and 100 mg/ml of streptomycin The metaphases were conventionally stained in Giemsa and 15 analysed for each animal III...
Ngày tải lên: 09/08/2014, 22:22
báo cáo khoa học: "Changes in the distribution of the genetic variance of a quantitative trait in small populations of Drosophila melanogaster" docx
... lines The phenotypic variance of the trait in the i th line is V and ; , the mean and the variance of the distribution of the variances of the lines are V and V(1; ), respectively In each line, ... environmental variance between the lines, the variances of the phenotypic and additive variances of the lines will be the same and, therefore: where fl j CV(V and h are the coefficient of variation of the ... to the evolution of the between- and within-line variance of a quantitative trait In such analyses, the between-line variance, in the absence of maternal effects, is essentially genetic, although...
Ngày tải lên: 09/08/2014, 22:22
Báo cáo y học: "Ultrasound in the diagnosis of a median neuropathy in the forearm: case report" doc
... anatomic abnormalities [3,5] This case demonstrates that it may be valuable in establishing an anatomic etiology and directing appropriate management in a diagnostically challenging case of median ... subsequent healing It has been shown that HRUS may be used as an adjunct to physical examination and electrodiagnostic findings in the diagnosis of nerve entrapment neuropathies in the absence of anatomic ... exploration in the proximal forearm with planned neurolysis was pursued A longitudinal incision was made in the anterior forearm just distal to the antecubital fossa The median nerve was identified,...
Ngày tải lên: 10/08/2014, 10:20