generalized approach to determine pressure drop in a pipe

... the average capacity increase for allocating less or equal crosstalk cancellation taps than rs is set to zero, (ii) the average capacity increase for allocating more crosstalk cancellation taps ... the average capacity increases per allocated crosstalk cancellation tap For each of K tones the capacity increase has to be calculated for all N − crosstalk cancellation configurations To be able ... that in each iteration of the algorithm a minimum of and a maximum of N − crosstalk cancellation taps are allocated Because of this varying granularity, the crosstalk cancellation tap constraint...

Ngày tải lên: 22/06/2014, 20:20

... showed values below -1.9 MPa, a value that is far from being able to induce stomatal closure in a xerophilous oak A plot of canopy surface resistance against vapour pressure deficit indicates a direct ... available energy was dissipated as latent heat in the morning, while an increasing amount of heat was released after midday Peak energy flux into the soil did not reach 70 W -2 m Heat stored into ... Mediterranean oak forest that has been investigated seems to dissipate most of the available energy as latent heat in the morning and gradually increase the release of sensible heat in the afternoon...

Ngày tải lên: 08/08/2014, 18:21

... types of financial transactions they are most related to Paragraphs that did not fall into a category of interest were classified as “other” The annotated paragraphs were divided into random 4x4 ... leading us to investigate visual ways to define queries that go beyond the paragraph and span many texts over many years Finally, we are hoping to conduct user studies to validate our fundamental ... users indicate whether the paragraph is to be treated as a positive or a negative example of the category they are elaborating In our preliminary studies, we were able to achieve the peak performance...

Ngày tải lên: 08/03/2014, 21:20

... havaittiin, kun kitosaani adsorboitui pysyvästi selluloosamallipinnalle ilman elektrostaattisen attraktion vaikutusta Märän paperin lujuuden parantuminen korkeassa pH:ssa adsorboidun kitosaanin ... g/m2) were prepared in a laboratory sheet mould according to standard SCAN-C 26:76 Deionized water was used in the mould and NaHCO3 was added to maintain a constant salinity of 0.5 mM Handsheets were ... paper are of prime importance in regard to paper manufacturing and the end-uses of paper products as well as in paper recycling Almost as long as man has made paper, first by hand and then industrially,...

Ngày tải lên: 18/03/2014, 02:20

... answer can be provided Clarification dialogues are organized in a top-down way, along the GH In our approach, answers should include not only information about the involved constraints, but also about ... specific information is available For exainple, a step of die action of getting information on a course plan is to talk with the curriculum advisor, that can be •specialized in different ways according ... [Carberry, 90] S.Carberry Plan Recognition in Natural Language Dialogue ACL-MIT Press, 1990 [Carberry 90b] S.Carberry Incorporating Default Inferences into Plan Recognition Proc 8th Conf AAAI,...

Ngày tải lên: 31/03/2014, 06:20

... Text Mining Text mining is an “area within data mining that focuses on data from textual sources” (Feldman, 2003; Ye, 2003) Text mining is a large subfield of data mining It is an area that has developed ... stated that the objective of text mining is to determine the underlying information on which the data mining operations are applied” Text Mining Approaches There are three major approaches to ... research data are compared to the leadership skills needed that industry communicates in trade journals This comparison is determined using a subjective and approximate reasoning approach called...

Ngày tải lên: 01/06/2014, 13:57

... separated into two individual trachybasalt flows Tirinkatar-1 and Tirinkatar-2, and the Ashtarak lava flow Tirinkatar-1 and Ashtarak each have volumes ~0.5 km3 The largest volume flank lava flows are ... central portion of the lava flow simulation area) comprising lava flows from Shamiram, Atomakhumb, Dashtakar, Blrashark, and Karmratar volcanoes The ANPP site (black box) is located on the Shamiram ... on the Shamiram Plateau In addition, large-volume lava flows are found on the flanks of Aragats volcano, a 70-km-diameter basalt-trachyandesite to trachydacite volcano located immediately north...

Ngày tải lên: 21/06/2014, 19:20

... optimal operating point is associated with an approximation index list Lk The metadata contains the following information (1) Approximation candidate set indicator—the index of the optimal candidate ... optimal approximation for input set that adapts to the available computational resources We will show how to compute and embed metadata in the image as well as show a decoding algorithm to allow ... approximation 16 We plan to incorporate metadata size as a constraint of our approximation algorithm We are hopeful that the results in this paper along with the metadata size constraint can allow...

Ngày tải lên: 21/06/2014, 22:20

... We can even joke that the best way to make some data inaccessible is to file them in a large database Curiously, large databases may be even seen to act like astronomical black holes in the information ... other papers, which determine its coordinates in the (bibliographic) map of (materials) science In this way, definite data (a definite point in data space) is related to a definite point in bibliographic ... "Monte Carlo" method to rearrange various paragraphs of already-existing papers so as to create new papers, fitting them into (and causing no harm in) the category of "never-read" articles Prevention...

Ngày tải lên: 06/07/2014, 15:28

... Maruyama-Nakashita A, Nakabayashi K, Li W, Ogawa M, Yamauchi Y, Preston J, Aoki K, Kiba T, Takatsuto S, Fujioka S, Asami T, Nakano T, Kato H, Mizuno T, Sakakibara H, Yamaguchi S, Nambara E, Kamiya ... Kamiya Y, Takahashi H, Hirai MY, Sakurai T, Shinozaki K, Saito K, Yoshida S, Shimada Y: The AtGenExpress hormone and chemical treatment data set: experimental design, data evaluation, model data analysis ... interpretation and taking into account that during both early and late development ABA ST pathways and ABA-target responses are more active in the mesocarp, the hormone may play a more relevant role in the...

Ngày tải lên: 11/08/2014, 11:21

... genome ATTTACCCGCAGGTAAATTTAAAGCTTCAGTATTATGAAGCGCCTCCACTAGTCTACTTGCATATCTTACAAGAAAATTTATAATTCCTGTTTTCGCCTCTCTTTTTTCCA ATTTACCCGCAGGTAAATTTAAAGCTTTACTATGA -AACGCCTCCACTAGTCTAATTGCATATCTTATAAGAAAATTTATAATTCCTGTTTTCCCCTCTCTTTTTTCCA ... CCTCGATTTTATTTTCTAATGTTATTGCAATAGCTCGGTATAATGTAACCATGTTACTAGCTTAAGATGGTTAGGGTTTCCCACTTAGGATGCATGAAATATCGCATTGGA CCTCGATTTTATTTTCTAATTTCTTCATATTGGCAAGTGCATAACTTTGCTTCCTCTCTGT -CTCGTTTTTTTG -TCTCTAAGATTTCCATTGCATTTCGAGGTAGC ... -AACGCCTCCACTAGTCTAATTGCATATCTTATAAGAAAATTTATAATTCCTGTTTTCCCCTCTCTTTTTTCCA ATTTACCCGCAGGTAAATTTAAAGCTTTATTATTATGAAACGCCTCCACTAGTCTAATTGCATATCTTATAAGAAAATTTATAATTCCTGTTTTCCCCTCTCTTTTTTCCA B A genome B genome D genome CCTCGATTTTATTTTCTAATGTTATTGCAATAGCTCGGTATAATGTAACCATGTTACTAGCTTAAGATGGTTAGGGTTTCCCACTTAGGATGCATGAAATATCGCATTGGA...

Ngày tải lên: 12/08/2014, 03:21

... TCCGGAGAAATTGCCAAATTAAAATGAATCATTTGGCCCATAATGGCCGAGGCGCTTATCGCGGA TCCGGAGAAATTGCCAAATTAAAATGAATCATTTGGCCCATAATGGCCGAGGCGCTTATCGGGGG TCTGGTGAAATTGCCAAATTAAAATGAATCATTTGGCCCATAATGGCCGAGGCGCTTATCGGGGG TCCGGTGAAATTGCCAAATTAAAATGAATCATTTGGCCCATAATGGCCGAGGCGCTTATCGGGGG ... GTCCCCGCTCCCTCCGGAGAAATTGCCAAATTAAAATGAATCATTTGGCCCATAATGGCCGAGGCGCTTATCG GTCCCCACTCCCTCTGGTGAAATTGCCAAATTAAAATGAATCATTTGGCCCATAATGGCCGAGGCGCTTATCG GTCCCCACTCCCTCCGGTGAAATTGCCAAATTAAAATGAATCATTTGGCCCATAATGGCCGAGGCGCTTATCG ... TCCGGTGAAATTGCCAAATTAAAATGAATCATTTGGCCCATAATGGCCGAGGCGCTTATCGGGGG TAGCCCACGACAGCCAAATAATAATGAATCATTTCATAAATAATGGGTTTAGGGGCTTATCGGGA Rn Mm Pt Hs Fr GTCCCCGCTCCCTCCGGAGAAATTGCCAAATTAAAATGAATCATTTGGCCCATAATGGCCGAGGCGCTTATCG GTCCCCGCTCCCTCCGGAGAAATTGCCAAATTAAAATGAATCATTTGGCCCATAATGGCCGAGGCGCTTATCG...

Ngày tải lên: 14/08/2014, 16:20

... FST)/2; lAS = (European-Asian FST + Asian-African FST - European-African FST)/2; lAF = (European-African FST + Asian-African FST - European-Asian FST)/2 deposited research Statistical tests to identify ... 23% (Additional data file 2) Tryptases have been implicated as mediators in the pathogenesis of asthma and other allergic and inflammatory disorders [26] The suggestion of balancing selection in ... this paper Additional data file is a table listing the microsatellite primer sequences and annealing temperatures Additional data file is a table listing allele frequencies at each microsatellite...

Ngày tải lên: 14/08/2014, 17:22

... butyrate in vivo XII ABBREVIATION AAV Adeno-associated virus ABC ATP-binding cassette AcMNPV Baculovirus Autographa californica multiple nucleopolyhedrovirus Ad Adenovirus BBB Blood-brain-barrier ... death of a young male in an adenovirus gene therapy trial (Raper et al., 2003) 1.2.2.2 Adeno-associated virus (AAV) AAV consists of a non-pathogenic, small virion (20-24nm in diameter) containing ... differentiation or apoptosis can mediate tumor onset and progression, HDAC inhibitors may exert anticancer potential by activating differentiation programs, inhibiting cell cycle and inducing apoptosis...

Ngày tải lên: 12/09/2015, 10:15

... policies, urban conservation in various areas has been carried out on a discriminatory basis: in favor of certain elite groups As a matter of fact, Chinese and Indian structures are always dominant while ... potential affordances, which exist for a certain individual and are defined by the individual’s qualities M eanwhile, one can also talk about factors of PAC that are available and are related to the ... http://www.vme.org.vn/vietnam/education_detail.asp?ID=459 (accessed at 4:16pm on Oct 26, 2006) 11 16 and authorities to maintain and upgrade national heritages and ancient towns in Hanoi City, in Ha Tay and Bac Ninh...

Ngày tải lên: 14/09/2015, 08:39

... idea/ business Others Detached/ Attached objects a Is there any architectural objects as an integral part of the Quarter d If there is lacking architectural objects appropriate to ancient Quarter ... spaces a Is there any a sharing kitchen/ a place for cooking? b What are functions of the cooking spaces useful to you? food/ meal preparation for the family at a bounded area cook traditional ... Maintaining good relations between households - Public areas are wide and shared to each family, self-repair, protection and care  good spatial quality - All take care of public areas, facilities...

Ngày tải lên: 14/09/2015, 08:39

... semiconductor junction, package case, electrically insulating material, heatsink and air In most applications, heat or energy can be approximated as a single point source and flows through the material ... Thermal Resistance? Many factors influence the flow of heat They can be broken up into two types, internal factors and external factors The internal factors are device package size, die size, package ... resistance alone insignificant Industry Standard Thermal Resistance Measurements Industry standards exist as a means to standardize the measurement of thermal resistance Standards organizations...

Ngày tải lên: 11/01/2016, 11:40

... cardboard in half and writing a windows error message to make the Mac users laugh Pretend you're using an i-pod by placing a bee in each ear and holding a gaudy pencil case to be in a pain in everyone's ... charge 10 THINGS YOU WOULDN'T WANT FOR CHRISTMAS A dead robin in a sock, a relaxation CD that appears to be voiced by Ian Paisley A pair of trainers pickled in bree A vague sense of inadequacy ... resurecting the thoughts of others history is a corpse leave it alone it teaches us nothing except how to repeat past mistakes again and again and again WAR War what is it good for? Reinvigorating...

Ngày tải lên: 14/11/2012, 16:50

... production lines in actual soy-sauce producing plant to measure total mass, total organic carbon (TOC), total nitrogen (T-N), total phosphorus (T-P) and total chlorine (T-Cl) The values shown in the ... elements are main components of wastewater causing eutrophication of rivers and lakes Chlorine was also analyzed due to its large impact in recycle and reuse of wasted materials Toxic heavy metals ... [Kondo et al., 1996] The third way is to burn in a fireplace and use as a heat source for a factory The characteristics of low water content is now promoting the burning as a final treatment way of...

Ngày tải lên: 05/09/2013, 08:40