gene symbol ogdh isoform 3 of 2 oxoglutarate dehydrogenase e1 component mitochondrial
Expression dynamics of the hepatic mitochondrial proteome of the sod2+ mouse in response to troglitazone administration
Ngày tải lên :
12/09/2015, 11:08
... detoxification of O2•-) (Winterbourn, 20 08) Equations and show this 2O2•- + H+ O2•- + •NO O2•- + [4Fe-S ]2+ + 2H+ SOD H2O2 + O2 (Eq 1) ONOO- (Eq 2) [4Fe-S ]3+ + H2O2 (Eq 3) While O2•- is a substrate of SOD2, ... 1 53 4 .2. 2 .2 Mitochondrial glutathione transport 154 4 .2. 2 .3 PPAR-agonist mitochondrial targets 158 4 .2. 2.4 OXHPOS 161 4 .2. 2.5 Valine metabolism 1 62 4 .2. 2.6 ... al (20 04) Haasio et al (20 02a,b,c) Bedoucha et al (20 01); Haskins et al (20 01); Tirmenstein et al (20 02) ; Narayanan et al (20 03) ; Shishido et al (20 03) ; Bova et al (20 05); Masubuchi et al (20 06);...
- 226
- 1.8K
- 0
Báo cáo khoa học: Novel isoenzyme of 2-oxoglutarate dehydrogenase is identified in brain, but not in heart potx
Ngày tải lên :
23/03/2014, 06:20
... (17 28 ) average 13 (22 ) 12 ( 23 ) 5–10 average ( 13) (19) Average 65 : 35 (60 : 40) (50 : 50 to 80 : 20 ) 60 : 40 (55 : 45) 13 (21 ) ( 13) 70 : 30 (60 : 40) 11 (17) ( 12) 60 : 40 (60 : 40) 11– 13 (17– 23 ) ... ± SD E1o (OGDH + OGDHL) OGDH E2o Tissue A % E1o A % OGDH A % E1o ⁄ %OGDH A % E1o ⁄ %OGDH Brain Heart 0 .34 ± 0. 03 100 0 .22 ± 0.04 0.48 ± 0.1 100 100 0.14 ± 0.05 0.57 ± 0.01 40 ⁄ 60 120 0. 23 ± 0.01 ... 198 579 400 126 196 151 12 975 709 27 9 NA NA 36 28 43 8 53 39 29 9 716 519 20 26 NA NA 6b 57657 5609 02 93 FEBS Journal 27 5 (20 08) 4990–5006 ª 20 08 The Authors Journal compilation ª 20 08 FEBS No...
- 17
- 389
- 0
Tài liệu Báo cáo khoa học: Characterization of promoter 3 of the human thromboxane A2 receptor gene A functional AP-1 and octamer motif are required for basal promoter activity docx
Ngày tải lên :
19/02/2014, 16:20
... Prm2 E1b Prm3 -1979 - 139 4 -33 08 E2 Prm1 +786 +1 +1 Luc - 139 4 -106 -50 +786 +1 Luc -404 +1 Luc - 32 0 +1 Luc -154 E2 +1 +1 Luc -975 +1 Luc - 32 0 Prm3 -1979 - 139 4 +1 Luc +1 Luc -404 Prm2 E1b -33 08 ... - 139 4 -33 08 -106 -50 pGL3Basic 10 12 E2 +786 +1 +1 Luc +1 Luc -404 +1 Luc - 32 0 +1 Luc -154 Luc -154 +1 Luc +1 Luc - 32 0 Prm3 -1979 - 139 4 -975 +1 Luc -404 Prm2 E1b -33 08 - 139 4 +1 Luc -975 E1 -5895 ... Luc - 32 0 - 32 0 - 32 0 *** - 32 0 Luciferase Activity (RLU) C 10 12 D AP-1 +1 Promoter Luciferase Activity (RLU) AP-1 - 139 4 +786 - 139 4 E2 - 139 4 +1 Luc - 139 4 +1 Luc - 139 4 +1 Luc **** +1 Luc +786 E2 ***...
- 18
- 509
- 0
Tài liệu Báo cáo Y học: A novel meta-cleavage dioxygenase that cleaves a carboxyl-groupsubstituted 2-aminophenol Purification and characterization of 4-amino-3-hydroxybenzoate 2,3-dioxygenase from Bordetella sp. strain 10d doc
Ngày tải lên :
21/02/2014, 01:21
... Precise measurement of the G + C content of deoxyribonucleic acid by 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 high-performance liquid chromatography Int J Syst Bacteriol 39 , 159–167 Moss, ... MgSO4Æ7H2O, and mg each of CaCl2Æ2H2O, CuSO4Æ5H2O, ZnCl2, and FeSO4Æ7H2O, with deionized water in 30 0 mL total volume Solution C contained 2. 4 g 4-amino -3- hydroxybenzoic acid, 6.0 g Na2HPO4Æ12H2O, ... and gene analysis of catechol 2 ,3- dioxygenase from the aniline-assimilating bacterium Pseudomonas species AW -2 Biosci Biotechnol Biochem 62, 747–7 52 Ó FEBS 20 02 4-Amino -3- hydroxybenzoate 2 ,3- dioxygenase...
- 7
- 490
- 0
Báo cáo khoa học: 15-Deoxy D12,14-prostaglandin J2 suppresses transcription by promoter 3 of the human thromboxane A2 receptor gene through peroxisome proliferator-activated receptor c in human erythroleukemia cells ppt
Ngày tải lên :
07/03/2014, 21:20
... AGGTACCGCTGCAGTGAGCCTTGATTG -3 , nucleotides )27 6 to )25 7) Prm3abb; pGL3b:Prm3abb (Primer Kin2 12, 5¢-dGAG AGGTACCGAGCAAGACTCTGTCTCAAA -3 , nucleotides )22 9 to )20 9) Prm3abc; pGL3b:Prm3abc (Primer Kin 23 6 , 5¢-dGAG AGGTACCCCGGAGAGGATATTTGAGCTG -3 , ... Journal 27 2 (20 05) 4754–47 73 ª 20 05 FEBS A T Coyle et al Effect of 15d-PGJ2 action on TP gene expression A B Fig Sub-localization of the site of action of 15d-PGJ2 within Prm3 (A) A schematic of the ... Journal 27 2 (20 05) 4754–47 73 ª 20 05 FEBS A T Coyle et al Effect of 15d-PGJ2 action on TP gene expression A B Fig Identification of the site of action 15d-PGJ2 site of action within Prm3 by site-directed...
- 20
- 432
- 0
Báo cáo khoa học: NovelN,N¢-diacyl-1,3-diaminopropyl-2-carbamoyl bivalent cationic lipids for gene delivery – synthesis,in vitro transfection activity, and physicochemical characterization docx
Ngày tải lên :
23/03/2014, 07:20
... 131 .40 130 . 52 (C=C), 73. 44 (CH), 65 .34 , 59 .28 , 58.46, 46.96, 46.77, 40.58, 37 .86, 33 .86, 33 .77, 33 .70, 30 .94, 30 .90, 30 .84, 30 .79, 30 .71, 30 .66, 30 . 62, 30 . 53, 30 .50, 30 .40, 30 .38 , 30 . 32 , 30 .27 , ... 23 C 59 .27 55.98 46.91 38 .70 70.49 54.08 37 C 4.89 2. 55 1 .39 3. 03 3.43a 3. 30 64.90 60.61 55.61 56.06 3. 22 2. 29 3. 41 3. 81 57. 92 6.41 37 .75 41. 62 40 .29 48.68 23 . 73 39.04 37 C 2. 01 ... 4.754. 73 (m, 1H, CH), 3. 5 63. 52 [m, 4H, (CH2)2NC(O)], 3. 3 73. 29 [m, 4H, CH2NHC(O)], 2. 4 42. 41 [m, 4H, (CH2)2N], 2. 2 62. 24 [d, coherent peak, 12H, N(CH3 )2] , 2. 1 92. 15 (t, 4H, CH2CO), 2. 001.95 (m, 8H, CH2CH=CHCH2),...
- 15
- 318
- 0
A Prince of Sinners E. Phillips Oppenheim BOOK 3 CHAPTER 2 pot
Ngày tải lên :
06/07/2014, 05:20
... is, of course, no concern of mine, but if they are left unanswered surely your funds must suffer." "There have been no signs of it up to the present," Brooks answered "We have large sums of money ... any pressure from outside You are all the sooner likely to grow out of conceit with them Therefore let me offer you a word of advice Publish your accounts, and sue Lavvy for a thousand pounds." ... for a moment "My own idea," he said, slowly, "was to take no notice of these attacks The offices where the financial part of our concern is managed are open to our subscribers at any time, and...
- 11
- 249
- 0
Dictionary of Engineering Episode 3 Part 2 ppt
Ngày tải lên :
21/07/2014, 15:20
... ratio of the radius of the tube to the radius of the float ¨ Symbol St2 { stoks ¦nəmиbər tu } ¯ stone [MECH] A unit of mass in common use in the United Kingdom, equal to 14 pounds or 6 .35 02 931 8 ... sputtering The ejection of atoms or groups of atoms from the surface of the cathode of a vacuum tube as the result of heavy-ion impact The use of this process to deposit a thin layer of metal on a glass, ... V of a mechanical system during small displacements from an equilibrium position, by means of the equation V ϭ 1/2qTKq, where q is the vector whose components are the generalized components of...
- 25
- 512
- 0
Handbook of Mechanical Engineering Calculations ar Episode 3 Part 2 pps
Ngày tải lên :
05/08/2014, 09:20
... in; other symbols as before For a / L ϭ 0.5, Kq ϭ 36 Then Q ϭ (36 )(164,000)(0.005 )3 / [(1 92) (7 )2 (39 3 ϫ 10Ϫ7)] ϭ 1.99 in3 / s ( 32 .6 cm3 / s) This can be rounded off to 2. 0 in3 / s ( 32 .8 cm3 / s) ... [ (2) (3) (0.0 03) 3 (2) 2] ϭ 759 lb / in2 (5 23 3 .3 kPa) Analyze the larger-clearance bearing Use the same procedure as in steps through Then ⑀ ϭ 0 .33 3; A ϭ 45.0; B ϭ 42. 0; Q ϭ 0.560 in3 / s (9 .2 cm3 / s) ... Ak ϭ 12[ 2 Ϫ ⑀ / (1 Ϫ ⑀ )2] ϭ 12[ 2 Ϫ 0.667 / (1 Ϫ 0.667 )2] ϭ 144.6 A second eccentricity constant B is given by Bk ϭ 12{ ⑀(4 Ϫ 2) / [2( 1 Ϫ 2) 2] ϩ ϩ 2 / (1 Ϫ 2) 2.5 ϫ arctan [1 ϩ ⑀ / (1 Ϫ 2) 0.5]}...
- 48
- 368
- 0
Handbook of Mechanical Engineering Calculations ar Episode 3 Part 2 ppsx
Ngày tải lên :
05/08/2014, 09:20
... in; other symbols as before For a / L ϭ 0.5, Kq ϭ 36 Then Q ϭ (36 )(164,000)(0.005 )3 / [(1 92) (7 )2 (39 3 ϫ 10Ϫ7)] ϭ 1.99 in3 / s ( 32 .6 cm3 / s) This can be rounded off to 2. 0 in3 / s ( 32 .8 cm3 / s) ... [ (2) (3) (0.0 03) 3 (2) 2] ϭ 759 lb / in2 (5 23 3 .3 kPa) Analyze the larger-clearance bearing Use the same procedure as in steps through Then ⑀ ϭ 0 .33 3; A ϭ 45.0; B ϭ 42. 0; Q ϭ 0.560 in3 / s (9 .2 cm3 / s) ... Ak ϭ 12[ 2 Ϫ ⑀ / (1 Ϫ ⑀ )2] ϭ 12[ 2 Ϫ 0.667 / (1 Ϫ 0.667 )2] ϭ 144.6 A second eccentricity constant B is given by Bk ϭ 12{ ⑀(4 Ϫ 2) / [2( 1 Ϫ 2) 2] ϩ ϩ 2 / (1 Ϫ 2) 2.5 ϫ arctan [1 ϩ ⑀ / (1 Ϫ 2) 0.5]}...
- 48
- 262
- 0
Handbook Of Shaft Alignment Episode 3 Part 2 pot
Ngày tải lên :
05/08/2014, 11:20
... Edition DK 4 32 2_ C019 Final Proof page 622 622 26 .9 .20 06 8:43pm 04 05 Far indicator Near indicator Shaft Alignment Handbook, Third Edition 04 02 02 01 + _ 05 04 03 03 04 03 03 02 02 01 01 _ + 01 12 in ... 20 20 Near indicator 30 30 40 50 40 10 Far indicator _ + 10 20 20 30 30 40 50 40 Taking measurements on the outside of a cylinder 40 50 40 40 30 30 20 10 _ + 10 Far indicator 20 50 40 30 30 20 ... Edition DK 4 32 2_ C019 Final Proof page 6 23 26 .9 .20 06 8:43pm 6 23 Bore Alignment Barrel Up Side view Motor Far indicator Near indicator T T 36 E Scale: 10 in 20 mils W Ϫ14 +24 E W +16 B 20 B +10...
- 30
- 283
- 0
The Cambridge History of the English Language Volume 3 part 2 ppsx
Ngày tải lên :
05/08/2014, 14:20
... ] and beyond 3. 4 .2 .3 Post-GVS raising (ME /a /) and the meet/meat merger (ME /e , /) The end of the traditional GVS proper (3. 2 .3. 1, 3. 2 .3. 3) is the completion of the raisings of the Middle ... and adding long [a ] (war, torn: 3. 4 .2. 7) Monophthongisation of ME diphthongs except /oi/ (boy), /ui/ (join), /iu/ (new), /u/ (dew: 3. 4 .2. 13. 4 .2. 2, 3. 4 .2. 4, 3. 4 .2. 6) (b) (c) (d) (e) These changes ... (presupposing earlier [ ] < / /: 3. 4 .2. 7); though even these have variants with / /, or old-fashioned / / (For the modern reexes of ME /a/ in all, pass see 3. 4 .2. 2, 3. 4 .2. 7.) 3. 4.1 .2 ME /e/ and /o/ (set,...
- 69
- 418
- 0
Design and Optimization of Thermal Systems Episode 3 Part 2 pdf
Ngày tải lên :
06/08/2014, 15:21
... obtain the optimum This leads to the equation 20 41.67 (2. 9 1/ V )2 V 20 8 or 2. 9V (9.816)1 /2 3. 133 Therefore, V * 1. 425 m3 Then, A* 26 . 536 m2 and U * 122 5.16 It can easily be shown that if V or A ... and Optimization of Thermal Systems F1 ( x1, x2 , , xn , , , m ) U x1 G1 x1 G2 x1 m Gm x1 F2 ( x1, x2 , , xn , , , m ) U x2 G1 x2 G2 x2 m Gm x2 Gm xi Fi ( x1, x2 , Fn j ( x1, x2 , , xn , , , , ... obtained in terms of V from this equation and substituted in the objective function to obtain an unconstrained problem as U (35 ) 5 833 .3 29 0 100/V 20 8V Minimum or U 20 41.67 2. 9 1/V 20 8V Minimum Therefore,...
- 25
- 396
- 0
Báo cáo khoa học: "Teratological effect of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD): induction of cleft palate in the ddY and C57BL/6 mouse" pptx
Ngày tải lên :
07/08/2014, 14:23
... No of mother 4 3 No of fetus 44 28 33 18 24 80 No of early died fetus 1 (2. 27) 3( 10.71) 4( 12. 12) 2( 8 .33 ) No of late died fetus 0 1(5.56) No of fetus with CP 15 (34 .09)* 8 (28 .6)* 9 (27 .3) * 5 (27 .8)* ... 0 1 (3. 33) 1(5.88) No of mother 5 4 No of fetus 41 44 32 30 17 40 No of early died fetus 1 (2. 44) 1 (2. 27) 2( 6 .25 ) 4( 13. 33) 2( 17.76) No of late died fetus 0 0 No of fetus with CP 1 (2. 44) 8 (25 .0)* ... 1 (3. 45) 1 (2. 7) 1(4.0) No of fetus with CP 0 0 No of mother 5 2 No of fetus 14 38 30 16 17 20 No of early died fetus 3( 21 . 43) 2( 5 .26 ) 3( 10.0) 2( 12. 5) 4( 23 . 53) No of late died fetus 0 0 No of fetus...
- 7
- 659
- 0
Material Science_ Vol 1 of 2 - US DOE (1993) WW Part 3 docx
Ngày tải lên :
11/08/2014, 14:20
... of bulk defects MS-01 Page vi Rev Structure of Metals DOE-HDBK-1017/1- 93 BONDING B ONDING The arrangement of atoms in a material determines the behavior and properties of that material Most of ... characteristics as compared to pure metals 1. 12 IDENTIFY the two desirable properties of type 30 4 stainless steel 1. 13 IDENTIFY the three types of microscopic imperfections found in crystalline ... electrical current are determined by the freedom of movement of electrons This is dependent on the type of bonding present Knowledge of the microscopic structure of a material allows us to predict how...
- 8
- 209
- 0
Material Science_ Vol 2 of 2 - US DOE (1993) WW part 3 docx
Ngày tải lên :
11/08/2014, 14:20
... ∆l from Equations (3- 1), (3- 2) , and l (3- 3) E = stress strain = F/A ∆l l (3- 3) or ∆l = F/A E (3- 4) α∆T = F/A E (3- 5) F/A = Eα∆T F/A = thermal stress (psi) E = modulus of elasticity (psi) α = linear ... Coefficients of Linear Thermal Expansion Material Coefficients of Linear Thermal Expansion (°F-1) Carbon Steel Stainless Steel 9.6 x 10-6 Aluminum 13. 3 x 10-6 Copper 9 .3 x 10-6 Lead MS- 03 5.8 x 10-6 16 .3 ... Table 1) E = 3. 0 x 107 lb/in .2 (from Table 1, Module 2) ∆T = 540°F - 60°F = 480°F Stress = F/A = Eα∆T = (3. 0 x 107 lb/in .2) x (5.8 x 10-6/°F) x 480°F Thermal stress = 8.4 x 104 lb/in .2 (which is...
- 8
- 303
- 0
Báo cáo y học: "A poxvirus Bcl-2-like gene family involved in regulation of host immune response: sequence similarity and evolutionary history" pptx
Ngày tải lên :
12/08/2014, 04:20
... Acids Res 20 00, 28 : 23 5 -24 2 22 Ginalski K, Elofsson A, Fischer D, Rychlewski L: 3D-Jury: a simple approach to improve protein structure predictions Bioinformatics 20 03, 19:1015-1018 23 Proteinkeys ... analysis of a complete Page 12 of 12 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 poxvirus transcriptome reveals an immediate-early class of genes Proc Natl Acad Sci USA 20 08, 105 :21 40 -21 45 ... C16/B 22 Recent studies on vaccinia virus transcription revealed the existence of an immediate-early class of genes [ 42] This class includes five genes of this family (A52R, B15R, C6L, K7R and N2L),...
- 12
- 306
- 0