gan b thận c thận và cơ

... tạo D Ribose: A B C CHO CHO CHO CHO CHO CH2OH CH2OH CH2OH CH2OH CH2OH 69 D E Tr c nghiệm hoá h c chuyển hoá glucid Block 81 Trong c u tạo acid hyaluronic c : A H3PO4 B N Acetyl Glucosamin C H2SO4 ... thu, rượu đư c: A Đưa vào mạch b ch huyết B. Bị biến đổi trư c vào máu C. Không b biến đổi trư c vào máu D .B biến đổi thành aldehyd trư c vào máu E B biến đổi thành acid acetic trư c vào máu 81 ... Galactose E Mannose 81 Phản ứng Molish dùng để nhận định: A C c chất Protid B C c chất acid amin C C c chất c nhóm aldehyd D C c chất c nhóm ceton 66 Tr c nghiệm hoá h c chuyển hoá glucid Block...

Ngày tải lên: 23/03/2014, 07:20

... Breast cancer, LC- Lung cancer, NSCLC- Non small cell lung cancer, SSC- squamous cell carcinoma, CRColorectal cancer, CML- Chronic myeloid leukemia, GIST- Gastrointestinial stromal tumor, CTCL-Cutaneous ... Genetech BC [46] Her-2/neu Her-2/neu EGFR Madarex Genetech Imclone BC BC, PC, OC Pan .C, BC, RenC FDA approved Phase I Phase II Phase III [78] - PKC-α PKA ISIS Hybridon NSCLC, BC, Pan .C CR, Pan .C, ... Translocation t(5:12) BCR-ABL TEl-ABL TEL-PDGF Disease Chronic myeloid monocytic leukemia Non small cell lung carcinoma Bladder cancer Glioblastoma multiforme Autocrine-paracrine loop Glioma Autocrine-paracrine...

Ngày tải lên: 03/11/2012, 09:57

... upon checkpoint activation Binds to Mad1, binds and inhibits APC/CCdc20 Protein kinase, binds to Bub3 and APC/CCdc20 , binds to the mitotic motor protein CENP-E Protein kinase, binds to and recruits ... (Dobles et al 2000) Upon checkpoint activation, both BubR1-Bub3 and Mad2 are capable of blocking the activity of APC /C through their direct binding to Cdc20 (Yu 2002; Bharadwaj and Yu 2004) Binding ... Upon checkpoint activation both BubR1-Bub3 and Mad2 interact with Cdc20 and lead to an inhibition of APC Inactivation of the checkpoint occurs upon bipolar attachment to the mitotic spindle APC...

Ngày tải lên: 25/10/2013, 21:20

... signatures of Itk-deficient CD3+, CD4+ and CD8+ T-cells BMC Genomics 10, 233 54 Raberger J, Schebesta A, Sakaguchi S, Boucheron N, Blomberg KE, Berglof A, Kolbe T, Smith CI, Rulicke T & Ellmeier W ... the combined inactivation of BTK and TEC in mice causes a phenotype resembling XLA, thus delineating species-speci c redundancy The R2 8C mutation, which abolishes binding to activationinduced ... ITK could affect HIV replication, we treated activated peripheral blood mononuclear cells with the clinically approved proteasome inhibitor bortezomib (Velcade) TEC kinases and disease and challenged...

Ngày tải lên: 14/02/2014, 18:20

... interaction MAP2 RII CD1 CD2 CD3 MBD RII InterMBD action CD 1–147 148–599 600–1099 1100–1518 1519–1829 B IP PD Input Mouse IgG -MAP2 GST RII CD1 CD2 CD3 MBD A 250 150 IB: -v-KIND CD2 CD2-1 CD2-2 CD2-3 ... immunofluorescence and its colocalization with GFP fluorescence were observed by confocal microscopy Scale bar = 100 lm (B) Sholl analysis of the dendrite complexity of individual neurons Data were obtained ... MAP2 (catalog number: M1406; Sigma-Aldrich), EGFP (catalog number: SC-9996; Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA), Flag (catalog number: 3165; Sigma-Aldrich) and HA (catalog number:...

Ngày tải lên: 14/02/2014, 19:20

... primers: ACT2 (At3g18780): 5-ACATTGT GCTCAGTGGTGGA-3 and 5-CTGAGGGAAGCAAG AATGGA-3, OXI1 (At3g25250): 5-GACGAGATTATC AGATTTTACGC-3 and 5-AACTGGTGAAGCGGAAG AGAC-3, PTI1-4 (At2g47060): 5-CCCCAAAGAAAATG ... Antikorpertechnik GmbH & Co KG, Teningen, ¨ Germany) Membranes were developed by enhanced chemiluminescence, as recommended by the manufacturer (Gene Image, Amersham Biosciences) Yeast two-hybrid assays ... would be necessary to decipher the specificity of action of each cascade and what mechanisms restrict or regulate cross-talk between distinct pathways Experimental procedures PTI1-4, a common...

Ngày tải lên: 14/02/2014, 19:20

... by binding and antagonizing the anti-apoptotic Bcl-2 family members, thereby causing activation of Bax and Bak [23] Regulation of Bcl-2 family members can occur by a number of mechanisms, including ... anti-apoptotic members of the Bcl-2 protein family (Bcl-2, Bcl-xL, Bcl-w, Mcl-1 and A1), which contain four BH domains [22] The third subgroup, the BH3-only proteins, are structurally diverse and contain ... Bim reduction, indicating that Bim is essential for gefitinib-induced apoptosis of NSCLC cells The induction of Bim after treatment with gefitinib is a consequence of both transcriptional induction...

Ngày tải lên: 16/02/2014, 09:20

... pcitrine-N1 phPGK1–7aa–cerulean and phPGK1–5aa–cerulean were constructed using the primers 5¢-CCGGA ATTCC AATGT CGCTT TCTAA CAAGC T-3¢ and 5¢-GGCGG ATCCA TAATA TTGCT GAGAG CATCC A-3¢, and 5¢CCGGA ... oligonucleotides 5¢-GATCC GGGCG CCGGA-3¢ and 5¢-CCGGT CCGGC GCCCG3¢, and phPGK1–7aa–cerulean pCMV–hGAPDH was constructed by self-ligation of the blunt-ended AgeI–BspEI fragment of pcerulean–hGAPDH pCMV–hPGK1 ... inserted between the EcoRI and BamHI sites of pcerulean-N1 pcerulean–hPGK1 was constructed using the primers 5¢CCGGA ATTCG ATGTC GCTTT CTAAC AAGCT-3¢ and 5¢-GGCGG ATCCT TAAAT ATTGC TGAGA GCATC 1316 CHO-K1...

Ngày tải lên: 16/02/2014, 09:20

... [pii] 21 Chen AJ, Zhou G, Juan T, Colicos SM, Cannon JP, Cabriera-Hansen M, Meyer CF, Jurecic R, Copeland NG, Gilbert DJ et al (2002) The dual specificity JKAP specifically activates the c- Jun N-terminal ... mitochondrial cytochrome c triggers assembly of a caspase-9activating complex and subsequent activation of the downstream caspase cascade These pathways are not mutually exclusive and are connected ... JSP1-His6 constructs were expressed in Escherichia coli-BL21, cells were lysed by sonication in lysis buffer (50 mm Tris pH 7.0 ⁄ 100 mm NaCl ⁄ complete protease inhibitors; Roche), and recombinant...

Ngày tải lên: 16/02/2014, 14:20

... dimeric structure, as in CgAKb Monomer–dimer equilibrium In CgAKb, Thr binding induces the dimerization of CgAKb [20] Thr is bound at an effector-binding unit formed between two chains in TtAKb in ... et al., unpublished result), the direct function of the loop in catalytic control is unexpected in CgAK In TtAKb, accompanied by an outward shift of b- strands, especially b2 b4 from ACT1 near site ... of CgAKb (Table 2) Both CgAKb and TtAKb are more stable at 4.3–4.4 C in the presence of Thr Considering that TtAKb and, putatively, CgAKb are in equilibrium between monomers and dimers, and bound...

Ngày tải lên: 18/02/2014, 08:20

... Foster City, CA, USA) upon subcloning Recombinant virus was generated by transfecting Sf9 cells using the BaculoGold Transfection Kit (BD Biosciences Pharmingen, San Diego, CA, USA), according ... apparent discrepancy could be that PKA phosphorylation induces a conformational change that increases the accessible hydrophobic surface area, enabling freer access to the lipid-binding site, ... 5¢-ATC ATC TCC ATC GAC TAC TCC CTG-3¢, the antisense primer 5¢-AAG AAT TCT AGA TTA ATG GTG ATG ATG GTG ATG ATG GTG TGG GGT CAG CGG TGC AGC AGG GGG GGT-3¢ (XbaI sites underlined; His-tag in italic)...

Ngày tải lên: 18/02/2014, 11:20

... anti-tumor effects in patients with various cancers, particularly non-small cell lung cancer (NSCLC) [3–5] Beneficial responsiveness to EGFR-targeting chemicals in NSCLC patients is closely associated ... T, Fleet C, Cichowski K, Johnson BE & Cantley LC (2005) ErbB-3 mediates phosphoinositide 3-kinase activity in gefitinib-sensitive non-small cell lung cancer cell lines Proc Natl Acad Sci USA 102, ... Plasmid pcMKP1 was generated from Homo sapiens dual-specificity phosphatase cDNA, MGC clone (ID 4794895) purchased from Invitrogen (Carlsbad, CA, USA) The MGC clone had been cloned into pBluscriptR...

Ngày tải lên: 18/02/2014, 13:20

... inhibitor SB203580 enhances nuclear factor-kappa B transcriptional activity by a non-speci c effect upon the ERK pathway Br J Pharmacol 131, 99–107 46 Batts KP (1998) Ischemic cholangitis Mayo Clin ... of bile secretion or from an obstruction of the bile duct [49] As suggested by Fiorucci et al., activation of canalicular transporters, including BSEP, could negatively impact on intrahepatic bile ... 5¢-AACTTT GCTGGCCGCCGCCGCTGG-3¢ (sense) and 5¢-GGCAAC TAGAAGGCACAGTCGAGG-3¢ (anti-sense)] were used to generate the substitution of Pro402 for the alanine residue The resultant cDNA was subcloned...

Ngày tải lên: 18/02/2014, 13:20

... xenobiotic-inducible CYPs such as rat CYP1A1, CYP2E1 and CYP 2B1 , and mouse CYP1A1, contain chimeric noncanonical-targeting signals that are capable of targeting proteins to both the ER and mitochondria ... the indicated CYP1A1 constructs were probed with antibody to CYP1A1 (B) Extracts from cells transformed with CYP 2B1 (lanes and 6) and CYP2E1 construct were probed with either CYP 2B1 antibody (left ... inducible cytochromes P450 in rat liver mitochondria: immunological characteristics and patterns of xenobiotic substrate metabolism Arch Biochem Biophys 339, 136–150 Anandatheerthavarada HK, Biswas...

Ngày tải lên: 18/02/2014, 16:20

... initiation factor (eIF5) Saccharomyces cerevisiae Yeast 20, 97–108 Bandhakavi S, McCann R, Hanna DE & Glover CVC (2003) A positive feedback loop between protein kinase CKII and Cdc37 promotes the activity ... Mol Cell 12, 829–839 Feldman RM, Correll CC, Kaplan KB & Deshaies RJ (1997) A complex of Cdc4p, Skp1p, and Cdc53p ⁄ cullin catalyzes ubiquitination of the phosphorylated CDK inhibitor Sic1p Cell ... isozyme of CK2 (Quantitative evaluation is only shown for the respective Dcka1 or Dcka2 genetic background, respectively) Quantification of co-immunoprecipitates in the Dcka1 or Dcka2 genetic background...

Ngày tải lên: 18/02/2014, 16:20

... (5¢-GTGGCTGGAACAGGAGCGCCATATTTTACA ACTGATTCG) and F133A-rv (5¢-CGAATCAGTTGTAA AATATGGCGCTCCTGTTCCAGCCAC) The mutations were verified by DNA sequencing using the BigDye terminator cycle sequencing ... (5¢-GATTTTTGTGGCT GGAACAGGAAACCCATATTTTACAACTGATTCG) and F133N-rv (5¢-CGAATCAGTTGTAAAATATGGGT TTCCTGTTCCAGCCACAAAAAT), with the altered nucleotides shown in bold and underlined The F133A mutation was created ... Fig (A) Interactions between subunits A, B and C (B) Hydrophobic interaction between the a4 helices from A and B (C) Interaction between a7 helices from A and C Hydrogen bonds form between Thr197...

Ngày tải lên: 18/02/2014, 16:20

... might enhance Ca2+ mobilization by reducing Ca2+ removal via sarco- and endoplasmic reticulum Ca2+-ATPase (SERCA) inhibition, in a similar way to that proposed for pancreatic acinar cells [30] ... mm NaCl, mgÆmL)1 BSA and pm tissue factor) Coagulation was started by adding volume of buffer B (2.5 mm Z-GGR-AMC, 20 mm Hepes, 140 mm NaCl, 100 mm CaCl2 and 60 mgÆmL)1 BSA) Fluorescence accumulation ... 8070–8074 ´ Gachet C, Hechler B, Leon C, Vial C, Leray C, Ohlmann P & Cazenave JP (1997) Activation of ADP receptors and platelet function Thromb Haemost 78, 271–275 Hechler B, Zhang Y, Eckly A, Cazenave...

Ngày tải lên: 18/02/2014, 16:20

... QuantiTect SYBR Green one-step PCR kit, following the manufacturer’s suggested protocols The actin primers were as follows: forward, 5¢-CTACGTCGCCCTGGACTTCGAGC-3¢; reverse, 5¢-GATGGAGCCGCCGATCCACACGG-3¢ ... to induce membrane blebbing and promote the formation of actin stress fibers and disassembly of focal adhesions [17] These biological events can occur in cooperation with microtubuleassociated ... ProteoExtract Subcellular Proteome Extraction Kit (Calbiochem, La Jolla, CA, USA) was used to extract proteins from mammalian cells according to their cytosolic or cytoskeletal subcellular localization...

Ngày tải lên: 18/02/2014, 17:20

... processes Experimental procedures Cell lines and cell culture Frozen whole HeLa cells and HeLa nuclei were purchased from Cil Biotech (Mons, Belgium) HCT116 and HT29 cells (ATCC, LGC Promochem, ... TAC (Tyr) to TTC (Phe) with the forward primer: 3¢-GTCACAGAGCCACAGTTCCAG CCAGGA-5¢ Codon 305 of C- YES was mutated from AAA (Lys) to AGA (Arg) with the forward primer: 3¢-GG AACCACGAAAGTAGCAATCAGAACACTAAAACCA ... of the CDK activator Cdc25A and cell-cycle arrest by cytokine TGF-beta in cells lacking the CDK inhibitor p15 Nature 387, 417–422 15 Wang Z, Southwick EC, Wang M, Kar S, Rosi KS, Wilcox CS, Lazo...

Ngày tải lên: 18/02/2014, 18:20

... Sequences of the speci c primers included, for PPARb forward 5¢-GCAGCCTCTTCCTCA ATGAC-3¢, for reverse 5¢-GTACTGGCTGTCAGGGTG GT-3¢; CERK forward 5¢-TCTGCAAGGACAGACCCT CT-3, reverse 5¢-CAAGTGCCATTTGCTGAGAA-3¢; ... and nuclear extracts from SP1 cells The nucleotide sequences of putative CERK-PPRE, including the sense 5¢-CTCTCCAGGCCACAGGCCAGAGCGG-3¢ and anti-sense 5¢-GAGAGGTCCGGTGTCCGGTCTCGCC-3¢ sequences, ... CCAAGGGTGCTGTGCTC-3¢ and for reverse 5¢-TTGTT CTCACCAGACCCTTGAC-3¢ All reactions were run with a hot-start preincubation step of 10 at 95 C, followed by cycles of 15 s at 95 C and at 60 C The amount...

Ngày tải lên: 18/02/2014, 18:20