g functional parallels between fgsc and ssc

... during the viral life cycle, including positive-strand and minus-strand DNA synthesis, pre-genomic RNA packaging, and virion formation and release [17,18] This core protein is a phosphoprotein, and ... linked by a hinge region that varies in length and sequence among HPV types Notably, the relatively long hinge of EV HPV E2 proteins contains RS dipeptide repeats (Fig 1), which suggests a function ... during the viral productive stage, and perhaps functions throughout the early and late stages of the virus life cycle [51] E1^E4 protein interacts with SRPK1 through an arginine-rich domain and...

Ngày tải lên: 23/03/2014, 06:20

... 200 400 200 Amplifying from GS03135-GS02889 GS00132 phototropin homolog GS00920 phototropin homolog Orphan 1N clusters GS05223 false agglutinin homolog 200 Figure Cluster GS02894 displayed a sequence ... kinase, and GS00234, Genome Biology 2009, 10:R114 http://genomebiology.com/2009/10/10/R114 11h 21h 02h CL 11h 400 200 2N 21h gDNA 02h 2N 1N H2O 1N Genome Biology 2009, GS00217 elongation factor 1a GS00667 ... A: Epigenetic regulation of gene expression: how the genome integrates intrinsic and environmental signals Nat Genet 2003, 33:245-254 Phanstiel D, Brumbaugh J, Berggren WT, Conard K, Feng X, Levenstein...

Ngày tải lên: 09/08/2014, 20:20

... upstream of the lamine B2 origin sequence on chromosome 19, and have the following sequences: 5'-CTATGCCAAGCCCATTCTAGGTCCT-3 (sense); 5'-GCAGGGAAACTGTGCACAGCAAGAG-3' (antisense) Upon amplification ... dsRNAi system targeting endogenous MCM3 or MCM4, annealed oligonucleotides corresponding to partial sequence were designed and ligated to the pSuper.neo+GFP (OligoEngine) according to the manufacturer's ... instructions The cDNA sequence of the targeted mRNA region for different genes is as follows MCM3: 5'-AAACGAGAAGAGGGCTAAC-3' (nucleotides 171-189); MCM4: 5'GACACCACACACAGTTATC-3' (nucleotides 10951113)...

Ngày tải lên: 10/08/2014, 05:21

... structural homologies suggesting a common ancestral origin (e .g CD40 ligand from platelets and the tumor necrosis factor [TNF] superfamily of proteins, and tissue factor [TF] homologies with cytokine ... macrophages, and other antigen-presenting cells, but the essential co-operation and interactions between clotting and inflammation are well preserved and readily demonstrable in human physiology today ... response to tissue injury Functional interrelationships between clotting and the innate immune response The close ancestral and functional linkage between clotting and inflammation is readily...

Ngày tải lên: 12/08/2014, 19:21

... YH11 GCAACATGCCCAAGTTTTATTGTG TATCCTTATCTGTCTGGTCGAGTC AGCATCATGCCCAAGTTTTATTGTGA TTTCTCCCTCCAAAAATATTCAGTTA TCTCCTCTCCTCGAGATGGCGTGTGCTCGCCCACTG ACCGCCGCCTTCTCATCTGA TTCTCTGGAACAACCTTCTCG ATGGCCTCAGTTCCGAAAACCAACAAAATAGA ... association of Gua with RPL4 was shown in both human HeLa cells and mouse LAP3 cells We cotransfected either FLAG-tagged Gua and protein A-tagged RPL4, or FLAG-tagged RPL4 and protein A-tagged Gua into ... expression of FLAG-Gua and FLAG-RPL4 The signal intensity of the FLAG-Gua (Fig 2B) is greater than FLAG-RPL4 (Fig 2A), which is possibly due to higher expression level of FLAG-Gua in the LAP3...

Ngày tải lên: 20/02/2014, 01:20

... 286 redox-regulated genes covering all major functional groups, including photosynthesis, metabolism and signaling [13] Inhibitor treatments indicate that at least 54 genes are regulated directly ... redox systems The light quantity gradient is illustrated by a grey triangle, whereas the changing light quality is depicted by a scale ranging from white (including sunlight) to black (far-red ... transitions and LTR in response to short-term and long-term light quality gradients, the STN7 kinase might also integrate light intensity signals However, an increased number of physiological experiments...

Ngày tải lên: 16/03/2014, 06:20

... 5¢-AATTCATGAGGAGGTTTCTCTGTAACA-3¢; AnI19H 5¢-AGCTTGTTACAG-AGAAACCTCCTCATG-3¢; AnI17R 5¢-AATTCACGAGGAGGTTTCTCTGTACTA-3¢; AnI17H 5¢-AGCTTAGTACAGAGAAACCTCCTCG TG-3¢; AnI15R 5¢-AATTCACAGGAGGTTTCTCT-GTC ... containing 10 mM MgCl2 at 37 °C (C) Single-turnover, subsaturating endonuclease cleavage reactions with varying DNA substrates in TK9 buffer containing 10 mM MgCl2 and 10% glycerol Reactions containing ... bromophenol blue, 30% glycerol) and reaction products were separated on 1% agarose gels, dried under vacuum at 90 °C and were visualized by autoradiography RNA splicing assays Single- and multiple-turnover...

Ngày tải lên: 17/03/2014, 10:20

... HSP 16.3 and recombinant human aB-crystallin The molecular chaperone activity of MTB HSP 16.3 on CS aggregation was compared to the effect of human aB-crystallin on CS aggregation The aggregation ... 16.3 When 3.5 mM MgCl2 and mM KCl were added to a solution containing MTB HSP 16.3 and CS no effect on chaperone activity was observed The results using ATPcS and MgCl2 with KCl suggest the importance ... 30-min period The aggregation of CS was measured with the addition of different concentrations of MTB HSP 16.3 and in the presence or absence of ATP and ATP analogs (A) Aggregation of CS is plotted...

Ngày tải lên: 23/03/2014, 21:21

... WJ, Pruijn G: PAD, a growing family of citrullinating enzymes: genes, features and involvement in disease BioEssays 2003, 25:1106-1118 Masson-Bessière C, Sebbag M, Girbal-Neuhauser E, Nogueira L, ... LN, Mei G, Melino G, Lee SC, Steinert PM: Protein unfolding by peptidylarginine deiminase Substrate specificity and structural relationships of the natural substrates trichohyalin and filaggrin ... Cantagrel A, Serre G: In the rheumatoid pannus, anti-filaggrin autoantibodies are produced by local plasma cells and constitute a higher proportion of IgG than in synovial fluid and serum Clin Exp...

Ngày tải lên: 09/08/2014, 01:23

... incorporating the GagD205E substitution suggested shortening of the distance between Gag205 and Gag340 residues, which looked to be compensated by GagV340M substitution (Figure 4) The modeling can ... from Gag206-216-specific CTL recognition, but we found selection of both GagD205E and GagV340M mutations in viral genomes in one animal, R01-007 (Table 2) In this animal, GagD205E and GagV340M ... DNA by introducing the GagA312P mutation resulting in A-to-P substitution at the 312th aa in Gag into the SIVmac239Gag205E CA-coding region to obtain SIVmac239Gag205E312P (Figure 1) Analysis...

Ngày tải lên: 13/08/2014, 01:20

... Exchange Arrangements and Exchange Restrictions after 1979 and Exchange Arrangements and Exchange Restrictions after 1989 Khanna, Tarun 2000 “Business Groups and Social Welfare in Emerging Markets: ... Congo (Braz.) Costa Rica Denmark Dominican Rep Ecuador Egypt Ethiopia Finland France Ghana Germany Great Britain Greece Guatemala Honduras Hong Kong Iceland India Indonesia Iran Iraq Ireland ... variables and a lagged level of the dependent variables, the conditioning information included lagged growth, lagged national income, population growth, revolutions and coups, oil prices, and external...

Ngày tải lên: 24/10/2012, 08:50

... common in guttate psoriasis, can be explained by changes in the balance between CD4+ and CD8+ effector and regulatory cell subsets [20] Although the mechanisms underlying the association between ... TNF-α blocking agents [56, 57] have provided a major advance in the treatment of the disease Using these agents an integrated approach targeting at inflammation underlying both psoriasis and atherosclerosis ... patients and seem to correlate with psoriasis severity [41, 42] Angiogenesis is a recognized feature common to psoriasis and atherosclerosis and vascular endothelial growth factor (VEGF) is a...

Ngày tải lên: 25/10/2012, 11:40

... 2005, with Singapore in 2003 and with New Zealand from 1993 It is now in negotiating Free Trade Agreements with other countries and areas such as Japan, ASEAN, Malaysia, China, Chile and Gulf countries ... h and π f are home and foreign quarterly inflation rates respectively (based on CPI change); and S th−/1 f and S th / f are exchange rates at time the quarterly change in the nominal exchange ... on foreign exchange rate than the consumer goods market Figure and Figure present the structure of Australia’ foreign trade Figure Australia Imports in two different markets – Industrial and Consumer...

Ngày tải lên: 29/10/2012, 16:32

... Nông Lâm Nghiệp, NXB Nông Nghiệp, (3), tr.72-74 PHẠM NGỌC NAM, 2000 Hướng phát triển g rừng trồng Hội thảo trạng, đònh hướng giải pháp phát triển nông thôn Miền Đông Nam Bộ Đồng Bằng Sông Cửu ... Phần nghiên cứu thực nghiệm NXB Nông nghiệp PHẠM VĂN LANG, BẠCH QUỐC KHANG, 1998 Cơ sở lý thuyết quy hoạch thực nghiệp ứng dụng kỹ thuật nông nghiệp NXB Nông Nghiệp NGUYỄN VĂN LÊ, 1997 Phương pháp ... 133,4 KG/cm2 TÀI LIỆU THAM KHẢO PHẠM VĂN CHƯƠNG, 1997 Nghiên cứu sử dụng g tai tượng để sản xuất ván ghép Chuyên đề trường đại học Lâm Nghiệp, (1), tr 38-39 LÊ CÔNG HUỲNH, 1995 Phương pháp nghiên...

Ngày tải lên: 30/10/2012, 16:53

... is further highlighted and even though the fibroglandular and fibrocystic changes peaks are close, they are statistically separated Using the results in Table effective d-spacings have been found ... baggage by energy dispersive X-ray diffraction signatures at multiple scatter angles Nuclear Instruments and Methods in Physics Research A 2000; 449: 408-415 Mills RR, Hanby AM, Girling AC Diagnostic ... 0.46 and 0.4 nm for carcinoma, fibrocystic changes, adipose and fibroglandular tissues respectively Comparison of the measured signatures between the fresh and frozen tissues is shown in Figure...

Ngày tải lên: 02/11/2012, 11:08

... and analysed using a commercial image analyser Compared to Higuchi’s algorithm this technique is far more involved and time consuming With advances being made in the theoretical understanding ... excursion area was significantly different between the two groups when standing with their eyes closed (p < 0.05) However, Levene’s test for homogeneity suggests that significant findings for this variable ... randomly generated or data with too high a noise component the fractal dimension will tend towards 2, indicating that the signal is indiscriminately wavering about its underlying signal Peng,...

Ngày tải lên: 03/11/2012, 10:09

... difference Understanding culture is integral to learning and understanding a language Culture may be defined as "what" a society does and thinks, and language is "a particular how" of thought The common ... not only the knowledge of foreign language but also the understanding of culture The Vietnamese see a struggle between traditions and the free information The biggest thing that causes culture ... space and number of words in the lead to draw a whole picture for the readers: Cho dù giá xăng liên tục giảm thời gian g n đây, người thường phải di chuyển xe ôm phải trả mức giá cao ngất ngưởng...

Ngày tải lên: 07/11/2012, 14:44

... 2005, with Singapore in 2003 and with New Zealand from 1993 It is now in negotiating Free Trade Agreements with other countries and areas such as Japan, ASEAN, Malaysia, China, Chile and Gulf countries ... h and π f are home and foreign quarterly inflation rates respectively (based on CPI change); and S th−/1 f and S th / f are exchange rates at time the quarterly change in the nominal exchange ... on foreign exchange rate than the consumer goods market Figure and Figure present the structure of Australia’ foreign trade Figure Australia Imports in two different markets – Industrial and Consumer...

Ngày tải lên: 26/03/2013, 11:10

... Exchange, 30 branches and 60 public relations • Northland region: exchanges (Hai Phong, Ha Noi), branches and 22 public relations • Midland region: branches and public relations • Westland region: ... billion VND Reorganizing organization structure and permitting foreign corporation invest capital is a symbol example for distinction of strategy sight and management acumen in tendency globalization ... dare think and is enterprising and they had acknowledgement worthy successes Độtôi management squad have range of visibility and always be thought vanguard in innovate work namely grandfather...

Ngày tải lên: 29/03/2013, 14:53