funding climate field schools using debt for development exchanges

... This page intentionally left blank Debt- for- Development Exchanges Debt- for- development exchanges are an important financing tool for development They make debt relief more politically and practically ... these bad loans sprang debt equity exchanges, which quickly begat debt- for- nature exchanges, and then debt- for- education exchanges, and most recently, debt- for- health exchanges And today, when ... in debt equity exchanges and debt- for- nature exchanges III Debt Equity Exchanges Debt equity agreements involve the sale of external debt by an investor to the debtor government in return for...

Ngày tải lên: 03/11/2014, 18:36

... Bryggerhøjskole Water as a source Brewing liquor has to be treated in different ways before it is suitable for gravity liquor Demineralisation: - ion exchange - reverse osmosis Active carbon filtration: ... tanks The yeast is removed and the beer matures in the tank for two to three weeks Thereafter the beer is stored at a temperature of -2°C for at least 24 hours, clarified in centrifuges, and filtered ... or "conditioned" for a certain period of time with a view to improvement of the flavour and chemical stability of the beer • After stabilisation and filtration the beer is ready for packaging The...

Ngày tải lên: 08/03/2014, 22:20

... To identify and generate information for the appropriate harvesting method (manual or mechanical) of rice to reduce grain cracking and losses 15 To improve the performance of current driers and ... mid-July 2006 (Figure 3), just in time for the wet-season harvest, and for experimental purpose This time the purpose of the experiment was to evaluate the performance and throughput of the dryer ... will be presented in the next report As planned, this information will be included in the training document for farmers 5.1.2 Drying of paddy using a reversible flat bed dryer Some preliminary experiments...

Ngày tải lên: 21/06/2014, 06:20

... 9: Typical force-deformation curve Figure 10: Breaking force depends on for a brown rice kernel moisture content (three rice varieties) Data points were plotted as an average breaking force of ... produced • Experiments are conducted for optimum drying conditions identified for high temperature compact dryers • Best drying condition identification for current flat-bed driers in MRD • New ... training • Study tours for 80 farmers and service providers • 130 service providers training for operating dryers at optimum conditions • 39 extension workers are trained with new information • Training...

Ngày tải lên: 21/06/2014, 06:20

... Figure 10: Demonstration of Nhat Thanh combined-harvester Figure 11: Gathering in field after harvesting demonstration for discussion Figure 12: Vice president of Tân Phát A cooperative,Mr Phan Thế ... Tân Hiệp district, Kiên Giang province + 124 farmers of Tan Hiep district 26/02/2007: Training for Giồng Riềng district Participants: + Local officers: - Lâm Thanh Hùng – Director of Extension ... July-2007 At Kien Giang Province Project: INVESTIGATION OF RICE KERNEL CRACKING AND ITS CONTROL IN THE FIELD AND DURING POST-HARVEST PROCESSES IN THE MEKONG DELTA OF VIETNAM Figure 1: Opening by Dr Truong...

Ngày tải lên: 21/06/2014, 06:20

... training lesson Figure 8b: Discussion on the drying performance at Tan Thoi co-operative, after training lesson Figure 9: Visit the reaper in field at Tan Thoi co-operative, after training lesson ... Cần Thơ province + 20 extension workers +195 farmers of Phong Dien district 23/09/2007: Training for Co Do district Participants: + Local officers: - HànAnh Dũng – Director of Extension Center ... 9a: Visit reaper at Tan Thoi co-operative, after training lesson Figure 9b: Discussion on the performance of the reper at Tan Thoi co-operative, after training lesson Nong Lam University Ho Chi...

Ngày tải lên: 21/06/2014, 06:20

... the field) the rice lots are dried by different methods: 196 Field drying Sun drying Artificial drying Field drying Field drying is practiced prior to threshing when hand or reaper is used for ... in the field for sun drying will be excluded in the calculation of drying losses Let rDL = reduced drying losses; Ld1 = losses for the case of before project activities; Ld2 = losses for the ... drying of panicle means that paddy after cutting was left in the field for sun drying (field drying) The value losses of 8.7% and 4% of field drying and sun drying on yard, respectively, were the...

Ngày tải lên: 21/06/2014, 06:20

... treatments from days before to days after maturity date (MD) with five replications for each treatment (Figure 1) Cutting and threshing operations were done manually using a sickle for cutting the rice ... from the furnace The paddy final moisture content is uniform at the desired level for storage For seed grain, the germination is high For commercial grain, the dried grain crack is minimized ... the reference value, particularly for 90 oC fluidized bed drying for 3.0 for which the outlet moisture content was below 17% (wet basis) The high head rice yield for variety A10 can be attributed...

Ngày tải lên: 21/06/2014, 06:20

... milling plant without polishing (accounts for 91%) • The brown rice milling system (accounts for 3%) • The final rice whitening/polishing plant (account for around 6% of total rice mills) In this ... (7-ton/h), the main purpose was to evaluate the current milling performance and find out a new approach for better milling performance MATERIALS AND METHODS 2.1 Installation of 7-ton/h rubber-roll ... can be seen in Table Ø 300 Ø 50 Figure Tray used for rice sample collecting 136 Table Milling performance of two milling systems M30RD† and M70RD†† for two rice drying practices sun drying vs mechanical...

Ngày tải lên: 21/06/2014, 06:20

... 16: Loss factors f and s for combination of field and sun drying currently practiced by farmers Actual drying method Full time sun drying Full time field drying Half time field drying and sun drying ... continue for dry season crop (harvesting season February/March) The survey data from farmers was collected during the winter-spring season for the same varieties The experimental data for the ... respectively Using a randomised block design, the rice was harvested days prior and days post-maturity stages in days intervals for OM 2718 and OM 1490 (Can Tho) and day interval for An Giang...

Ngày tải lên: 21/06/2014, 06:20

... places The subscripts V and E are for Vietnamese and English, respectively # The appendices 5, 6, and are the summaries of the training documents for Sep/07 for the harvesting time, the harvesting ... manuals for extension workers and farmers in English and Vietnamese • Extension pamphlets and posters Please note that not all the contents have been translated in English Only the essential information ... more information in the later training series They are shown in the Appendices of this report III APPENDICES # The appendices 1, 2, 3, and are the summaries of the training activities for the...

Ngày tải lên: 21/06/2014, 06:20

... 1 Institute Information Project Name Investigation of rice kernel cracking and its control in the field and during post-harvest processes in the Mekong ... methods to reduce grain losses (Year results) Interim research report on optimal drying conditions for high temperature compact dryers and flat-bed driers (year results) The report is divided into ... time and methods in two seasons (rainy 2006 and dry 2007) High temperature fluidised bed drying (using two rice varieties) Experimental results on flat bed drying including survey results on the...

Ngày tải lên: 21/06/2014, 06:20

... at 35oC for 3-4.4h 14 • For two passes: Period 1: fluidised bed drying at 80oC for 2.5 min, then tempering at 73oC for 40 min; Period 2: thin layer drying at 35oC for 7-9h or at 40oC for 5.5h ... parameters are as below: • For three passes: Period 1: fluidised bed drying at 83-87oC for 2.5 min, then tempering at 73oC for 40 min; Period 2: fluidised bed drying at 57oC for 4.9 min, and Period ... 57oC for 4.9 in the second pass and finally thin layer drying for 4.4 h) Op2 was the optimum condition obtained from RSM experiment using Jasmine rice variety (fluidised drying at 87oC for 2.5...

Ngày tải lên: 21/06/2014, 06:20

... in the field for sun drying will be excluded in the calculation of drying losses Let rDL = reduced drying losses; Ld1 = losses for the case of before project activities; Ld2 = losses for the ... their rice fields using their own equipments within only days harvesting time per crop For the operation time of 22-23 days per crop, 18 harvesters can harvest triple of cooperative rice field (3*478ha/crop) ... treatments from days before to days after maturity date (MD) with five replications for each treatment (Figure 1) Cutting and threshing operations were done manually using a sickle for cutting the rice...

Ngày tải lên: 21/06/2014, 06:20

... included pass FBD at 83oC for 2.5 subsequently tempering at grain temperature for 40 minutes, pass FBD at 57oC for 4.9 min, and then pass tray drying at 35oC for 4.4 h for IR50404 rice variety, ... drying including FBD at 80oC for 2.5min subsequently tray drying at 35oC for h (C1) or tray drying at 40oC for 5.5 h (C2) The controlled sample was tray drying at 35oC for 16h denoted by Ref The ... 143 Collaboration for Agriculture and Rural Development (CARD) Program There were 16 one-day training sessions for smallholder farmers and a workshop was arranged in Can Tho City for only extension...

Ngày tải lên: 22/06/2014, 12:20

... optimization Enhanced! Smart Proxy for faster and smoother HD editing New! Express Edit mode – make movies in minutes to share everywhere! Enhanced! Redesigned interface for a faster video-editing workflow ... Import from HDV, AVCHD, Blu-ray Disc and JVC HD camcorders New! Save videos as HD MPEG-4 files for the Web with H.264 compression New! Output HD movies on either DVD, or Blu-ray Disc with BD-J...

Ngày tải lên: 27/08/2012, 11:20

... into Formal and Informal types Formal Cooperation Formal linkage refers to institutional built linkage Activities are carried out based on “contract or Memorandum of Understanding (MOU)" Formal ... General iv 16 linkage 4.2 AHP Model Formulation 16 4.3 The AHP Model for Overall Linkage 17 Figure I.3 : Hierarchy for overall linkage 18 4.4 The AHP Model for Individual Linkage 18 Figure I.4 ... real case of a specific industry Problems for Research and Development units (GRI) Vietnam, for a long time, had had a centrally planned economy Therefore, most of GRI units belong to the government...

Ngày tải lên: 23/04/2013, 10:29

... One of them was for DNA extraction and was washed with TE buffer at pH8.0, and stored at -20oC Another was for FISH analysis and was stored at -80oC The extraction of DNA was performed with Fast ... cause of partial nitriifcation, the authors operated a test plant using simulated coak-oven wastewater prepared with chemical reagents for a period of about one year The nitrifiers population was ... was employed for the detection of Nitrobacter species, and the primer set NSR1113f CCTGCTTTCAGTTGCTACCG and NSR1264r GTTTGCAGCGCTTTGTACCG ( Dionishi et al., 2002) were employed for the detection...

Ngày tải lên: 05/09/2013, 09:38

... analysis has been used for the estimation of the overall reduction in the colony forming units (CFU) For this purpose, desoxycholate agar was used as the growth medium The samples before and after treatment ... media was added For FC count, these Petri dishes were inverted and incubated at 44.5°C for 18-20 - 178 - h; For TC count, these Petri dishes were inverted and incubated at 37°C for 18-20 h The ... were used as targets for disinfection in this study During this study, one set of operational conditions was applied for the device, as shown in Fig CO2 was filled the device before the experiment;...

Ngày tải lên: 05/09/2013, 10:15

... inform major movement in the teaching of writing (Raimes, 1983: 23760) According to Raimes, there are principal ways of approaching the task: focusing on form, focusing on the writer and focusing ... the need for learners to have linguistic knowledge about texts In addition, it is a fact that imitation is one way of learning The approach, therefore, has contributed considerably to the developments ... to organize the task Therefore, they not write on a given topic in a restricted time and hand in the composition for the teacher to correct The role of teachers, therefore, is as education facilitators...

Ngày tải lên: 07/09/2013, 13:51